<?xml version="1.0"?>

<!DOCTYPE rss PUBLIC "-//Netscape Communications//DTD RSS 0.91//EN"
             "http://my.netscape.com/publish/formats/rss-0.91.dtd">

<rss version="0.91">
  <channel>   

    <title>Medicinal and Computational Chemistry Job Market</title>
    <link>http://chemistry.freerecruiting.com/Resumes/JobOpennings/RssFeed</link>
    <description>This jobmarket focusses on placing Medicinal and Computational Chemistry Professionals.</description>
    <language>en-us</language>
















































































































































    <item>
     <title>Production Organic Chemist in Portland, OR
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8974/Forms</link>
      <description><![CDATA[TCI America, located in Portland, Oregon is a manufacturer & distributor of specialty organic chemicals to researchers in the pharmaceutical, bio-tech, and other related industries

Summary of Job Duties of a Production Chemist:
A. Performs established, standardized organic chemical experiments and R&D experiments according to batch record or assists method development of such experiments.
B. Assists in implementing new testing and analytical methods involving either automated analytical systems or manual laboratory analytical procedures
C. Completely and precisely record relevant information in laboratory notebooks and prepares analytical reports.
D. Studies reports from similar projects to learn more about the chemical processes involved.
E. Develops and suggests minor adaptations and fills in the gaps found in the newly developed guidelines that govern the new testing methods.
F. Extends and modifies approaches, precedents, and methods to solve a variety of chemical problems with unprecedented and obscure aspects
G. Solves problems and improves the methods and processes of organic synthesis, which often require the development, adaptation, and modification of precedents, methods, and procedures.
H. Assist in conducting research on manufactured products to develop and improve products
I.  Coordinate & operationally supervise the operations of other production chemists assigned to production department to maximize efficiency.

Necessary Knowledge, Skills and Abilities:
A. Advanced degree in Chemistry with experience in organic synthesis.
B. Knowledge in the interpretation of GC, HPLC, MS, and NMR sprectra
C. Working knowledge of Microsoft Word, Excel, PowerPoint and Chemdraw
D. Ability to multi-task & exercise independent judgment
E . Previous management experience preferred

TCI America offers competitive salaries, outstanding benefits to include employer paid health & dental insurance, 401(k) retirement plan with employer match as well as advancement opportunities.]]> </description>
    </item>


    <item>
     <title>Senior Manager, Research and Development in Toronto Ontario Canada
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8919/Forms</link>
      <description><![CDATA[Manage the development, implementation and evaluation of multiple process research projects according to client specifications.
Contribute to the evaluation and development of new inquiries (i.e. R+D cost and resource estimates)
Develops process research project plans in collaboration with other departments to ensure delivery of overall project objectives
Collaborate with R+D Managers in allocating project resources (lab space, equipment and staff)
Co-ordinate multi-functional project teams (e.g. analytical, technology transfer, process safety staff) and facilitate the resolution of outstanding issues
Monitor project progress through tools such as regular status meetings, schedule reviews, Gantt Charts
Lead in the management of staff through activities such as recruitment, performance management and staff development. Act as coach for staff in R+D Manager position.
Provide leadership to staff in R+D project leadership roles
Fulfil point of contact role for clients on scientific matters related to projects
Manage and review final project reports
Participate in project evaluations through report review, analysis and coaching
Fulfil leadership role in implementation of critical responsibilities (e.g. intellectual property tracking/co-ordination, FED)
Monitor compliance with relevant Standard Operating Procedures (SOP?s) and R+D Manuals
Ensure safe and clean lab operations]]> </description>
    </item>


    <item>
     <title> in bangalore
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/15569/Forms</link>
      <description><![CDATA[Please describe the job you are offering.]]> </description>
    </item>


    <item>
     <title>Staff Investigator, Organic Chemistry in Outside Boston MA.
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/1557/Forms</link>
      <description><![CDATA[Staff Investigator, Organic Chemistry
PhD in Organic Drug discovery provides a challenging environment in which to utilize your technical problem solving expertise in the application of organic synthetic chemistry to discovering new molecules designed for biological activity. The successful candidates will work in highly motivated, multifunctional teams, applying their proven synthetic skills to the application of our state-of-the-art parallel-automated chemistry platform to all aspects of Drug discovery. Here you will be exposed to all aspects of Drug discovery, advancing your knowledge and making valuable contributions to our Discovery pipeline by working in the area of library design and small molecule optimization towards biological targets. PhD in Organic Chemistry or related. Experience with solid-phase organic synthesis and characterization of biologically relevant small molecules necessary.. Familiarity with routine analytical techniques, including NMR, HPLC, and MS is required. or laboratory automation is a plus. The ideal candidate will combine their blend of motivation and synthetic skills with our team orientated Drug discovery programs to increase the success rate and efficiency of discovering and optimizing new potential medicines]]> </description>
    </item>


    <item>
     <title> in Hormel Institute at Univeristy of Minnesota
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/15649/Forms</link>
      <description><![CDATA[POSTDOCTORAL POSITION IN MOLECULAR MODELING AT THE HORMEL INSTITUTE UNIVERSITY OF MINNESOTA

A postdoctoral position is available immediately at the Hormel Institute, an independent research branch of the University of Minnesota, located in Austin, MN. The successful candidate will work closely with the Cellular and Molecular Biology group at the Hormel Institute, IBM and the Minnesota Supercomputing Institute. The position will primarily involve collaborative fundamental Cancer research using a variety of computational methods that will be corroborated with experimental findings. The successful candidate will
focus on the computational and modeling aspects in three primary areas of cancer research involving the study of protein-protein interactions along cellular signaling pathways, investigation of small molecule interactions with proteins, and the development of focus chemical libraries for chemical screening against protein targets. The successful candidate will be located at the University of Minnesota Supercomputing Institute in the Twin Cities with access to a wide variety of computer systems and state-of-the-art computational software
packages. In addition, the successful candidate will have access to Blue Gene/L, the most powerful supercomputer, at the OnDemand Center located at IBM Rochester, Minnesota. Regular trips to the Hormel Institute in Austin, Minnesota are expected.  Presentation of results in written reports or peer reviewed journal articles and seminars or symposia will be required.  A Ph.D. in chemistry, physics, biology or chemical physics is required. The successful candidate will have demonstrated experience applying molecular simulations packages such as Gaussian03, AMBER, LAMMPS, Docking programs, bioinformatics software and commonly used molecular modeling interface. Strong programming and knowledge of scripting languages is a plus. Strong written and oral communications skills are required. To apply, please your curriculum vitae to: ambode@hi.umn.edu.]]> </description>
    </item>


    <item>
     <title> in china
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/15823/Forms</link>
      <description><![CDATA[B.Sc biology]]> </description>
    </item>


    <item>
     <title>consultant in India
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/1585/Forms</link>
      <description><![CDATA[This company is looking for a few of its top Indian Pharma CLients,Heads for R&D. The incumbents have to be senior reserchers,having done Drug Discovery/Process Research.

Compensation is negotiable with a base of 300,000 USD]]> </description>
    </item>


    <item>
     <title>Manager R&D in UP
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/16029/Forms</link>
      <description><![CDATA[developemnt & scale up of aroma chemicals]]> </description>
    </item>


    <item>
     <title>Laboratory Equipment Systems Technician in Brielle, NJ
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/16142/Forms</link>
      <description><![CDATA[Laboratory Equipment Systems Technician Wanted: For reseller of new and reconditioned laboratory Equipment, parts, supplies, repair services and technical support. We are seeking a qualified individual to with a chemistry background to help us provide the highest quality service in the industry. This entry-level position requires experience operating and maintaining HP and Agilent GCs, GC/MS, and associated Data Systems. Willingness to learn and work within a team is required.
Alpha Omega Technologies in beautiful Brielle, NJ offers an extensive benefits package. Fax your resume to Human Resources at (732) 292-2311 or e-mail to spaleologos@aoti.net]]> </description>
    </item>


    <item>
     <title>Quality Assurance Manager in Boisar Near Mumbai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8522/Forms</link>
      <description><![CDATA[1.	Attend daily P & Q meetings and discuss daily quality issues to resolve them.
2.	Conduct CA/ PA meetings to discuss and implement solutions & problems
3.	Submit Reports to senior as required in the pre-determined time frames, viz. MPR reports , Quality reports etc.
4.	Attend monthly HPMC Project & Joint Quality Meetings conducted by directors.
5.	Conduct/ attend weekly TPM Progress Review Meetings.
6.	Carry out need based training for statistics, HVAC,HPMC, etc.
7.	Make aware and share information on various aspects of production, pin development, quality, etc with all persons of respective department.
8.	Keep update on regulatory and statutory standards ?Domestic & International.]]> </description>
    </item>


    <item>
     <title>Project/ Design  Manager in Boisar Near Mumbai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8521/Forms</link>
      <description><![CDATA[Qualification: B.E. Mech.
Experience: 8 -12 years:
Quality Assurance experience, preferred in Pharmaceutical Industry
With Good knowledge of Autocad]]> </description>
    </item>


    <item>
     <title>PURCHASE EXECUTIVE in Boisar Near Mumbai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8520/Forms</link>
      <description><![CDATA[Key Customers
Production HOD, HPMC/QA HOD, Machine Projects HOD, Store Assistants,Accounts HOD,
External Customers: Customs, DGFT-Commissioner , Octroi Department.

Key Responsibilities
1.	Development & Selection of Vendors on the merit of Quality , delivery and cost for components needed for the company for machines & equipments.
2.	Liaison with regulatory authorities such as customs , excise for exports
3.	To carry out MIS generation.
4.	Alert supervisors on rules and regulations getting newly introduced which affects affects import, export.
5.	Ensure compliance to FDA, cGMP,1SO 9001: 2000 & HACCP through periodic audits
6.	Train subordinate to fill up the competency gap for the job.

Key Activities
1.	Receipt of indent from all departments of the company.
2.	Floating enquires for domestic purchase and import.
3.	Raising purchase orders & getting those signed by superiors who are authorized for approval of PO?s.
4.	Follow up for supplies.
5.	Prepare dispatch report for customer in co-ordination with production departments of the company.
6.	Co-ordinate with clearing agents for exports of consignments, but selecting reliable and economical airlines , shipping lines.
7.	co-ordinate with Mumbai Municipality for octroi matters for exports of consignments.
8.	Arrange Form A for export consignments relevant to those countries who need it.
9.	Apply for DEPB benefits and liaison with DGFT for availing the benefits well in time.
10.	Co-ordinate with all departments and prepare annual budgets, develop and implement system for cost control through cost centre concept with budget as reference.
11.	Annual goal setting based on priorities agreed with company head.]]> </description>
    </item>


    <item>
     <title>Q.A./Q.C Manager in Boisar Near Mumbai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8519/Forms</link>
      <description><![CDATA[1.	Responsibility
2.	Ensure compliance to FDA ,CGMP,ISO 9001:2000 & HACCP Systems through periodic audits
3.	Ensure continual quality improvement.
4.	Ensure up gradation of product quality to world class status.
5.	Ensure redressal of customer complaints in a timely manner & develop and adopt appropriate solutions to prevent recurrence and occurrence of similar problems.
6.	Ensure product compliance as per the specifications prior to dispatch to customers.
7.	Train employees to increase awareness about quality.
8.	Improve systems in order to reduce the gap between actual practice and documented procedures.

Other responsibilities
1.	Discharge the responsibilities of TPM Co-ordinator for implementation of all the steps recommended by JIPM under the guidance of Corporate QA.
2.	Discharge all responsibilities relating to parenting of products.


Key Activities Performed
1.	Attend daily P & Q meetings and discuss daily quality issues to resolve them.
2.	Conduct CA/ PA meetings to discuss and implement solutions & problems
3.	Submit Reports to senior as required in the pre-determined time frames, viz. MPR reports , Quality reports etc.
4.	Attend monthly HPMC Project & Joint Quality Meetings conducted by directors.
5.	Conduct/ attend weekly TPM Progress Review Meetings.
6.	Carry out need based training for statistics, HVAC,HPMC, etc.
7.	Make aware and share information on various aspects of production, pin development, quality, etc with all persons of respective department.
8.	Keep update on regulatory and statutory standards ?Domestic & International.]]> </description>
    </item>


    <item>
     <title>Manager Commercial in Boisar Near Mumbai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8518/Forms</link>
      <description><![CDATA[Key Customers
Internal Customers : All departments in CCPL and corporate Finance.

External Customers: Banks, Governmental Officials (Excise), Customs, Sales Tax, Income Tax, Auditors (Statutory & Internal)

Key Responsibilities
1.	Maintain regular effective communication with customers on daily dispatches, Air & Sea Shipments.
2.	Co-ordinate with clearing & forwarding agents, customs for errorfree timely logistics compliance.
3.	Complete DEPB regular documentation.
4.	Ensure timely renewals of customs, octroi, & other relevant government permission / approval for smooth working of export function.
5.	Implement systems & monitor activities of purchase for cost effectiveness & quality improvement.
6.	Implement JIT concept in Raw material & vendored our item with plan to achieve targeted cost reduction.
7.	Maintain good co-ordial relation with excise , customs Income tax and related departments.
8.	Communication & keep update for related rules & regulatory requirements through consultants for sales tax, excise import, export income tax etc.
9.	Co-ordinate with corporate finances & auditors for regular audits and timely completion of balance sheet.
10.	Arrange return of rejected materials within scheduled time.
11.	Dispose scrap material of the plant inviting tenders and with the approval of the directors
12.	Arrange container for export consignment.
13.	Provide feedback to superior on issues affecting the companies performances in the area of purchase, import  export.]]> </description>
    </item>


    <item>
     <title> in hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/21579/Forms</link>
      <description><![CDATA[Drug desining/protein modeling]]> </description>
    </item>


    <item>
     <title> in hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/21578/Forms</link>
      <description><![CDATA[Drug desining/protein modeling]]> </description>
    </item>


    <item>
     <title>Research Scientist in Hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/21519/Forms</link>
      <description><![CDATA[MSc or PhD (Organic Chemistry) with industrial experience (min 2 yrs) in process development and technology transfers of APIs for regualted market and/or in handling Custom Chemical Synthesis projects.  The incumbent must possess sound laboratory skills and must be well versed with latest reactions and reagents.  Exposure to IPR, global regulatory reqts. and relevant analytical techniques.]]> </description>
    </item>


    <item>
     <title>Research Associate in Hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/21518/Forms</link>
      <description><![CDATA[MSc opr PhD (Analytical Chemistry) with min. 3 yrs exp in Analytical Method development and Validation of APIs for regulated market.  Hands on exp. on HPLC, GC, GC-HS, FT-IR etc and independent interpretation of analytical results is must.  Exposure to preparative HPLC, GC-MS LC_MS, DSC-TGA, XRPD, impurity profiling as well as GLP.]]> </description>
    </item>


    <item>
     <title>Research Scientist in Hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/21517/Forms</link>
      <description><![CDATA[Exp. in Process development and technology transfers of APIs for regulated market and/or in handling Custom Chemical Synthesis projects.  The incumbent must possess sound laboratory skills and must be well versed with latest reactions and reagents.  Exposure to IPR, global regulatory requirements  and relevant analytical techniques.]]> </description>
    </item>


    <item>
     <title>Trainee in Structural Bioinformatics, Biomolecular Modeling in Jena - Germany
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/1653/Forms</link>
      <description><![CDATA[Within the frame of EnTec's participation in the Jena Centre for Bioinformatics, we are seeking for a bright, highly
motivated and adaptive candidate to temporarily endorse our structural bioinformatics/ rational drug design group.

Job description:

The successful candidate will work on a collaborative research project with Global Research (GHC) of Schering AG.
(S)He will be responsible for in silico identification of putative receptor sequences for a growth factor protein, homology
modeling of suitable candidates, and for performing molecular dynamics refinement and docking simulations of the generated
structures. The position is available for 3 months.

Qualification:

The successful candidate will be preferably a Bioinformatics/Biochemistry/Chemistry undergraduate with basic knowledge
of /Willingness to learn genomic/protein sequence database search and analysis methods and tools. Skills with operating
systems (LINUX, UNIX, NT) and scripting languages (e.g. perl, awk/sed) are desirable.

Candidates interested in improving their curriculum and gaining valuable experience in the field of structural bioinformatics/
molecular modeling and simulation while being closely integrated in product-oriented drug discovery pharmaceutical industry
project are encouraged to send resumes and contact information as well as salary expecteations to the contact person.]]> </description>
    </item>


    <item>
     <title>Academic Faculty in Chemical Sciences in MUMBAI, INDIA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/16694/Forms</link>
      <description><![CDATA[The department of Chemical Sciences, Tata Institute of Fundamental Research (TIFR) , Mumbai, India is actively seeking applications from young, dynamic scientists with an innate urge for carrying out experimental or theoretical research of the highest quality in an area of current research activity or close to it. Applicants may also propose new and novel areas of experimental research in chemical sciences. In either case, a detailed research proposal must be included along with the CV.  Applications must be sent by e-mail or by post to the Chairperson ( dcs@tifr.res.in )of the Department or to the Director of the Institute (http://www.tifr.res.in).]]> </description>
    </item>


    <item>
     <title> in chennai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/16786/Forms</link>
      <description><![CDATA[Business Development Officers


Do you have the desire and competitive spirit that goes with being the best? Are you an award-winning sales person who loves to get in the field and hunt for new business? Do your customers view you as a business partner who finds solutions that address challenges they face in their business? If so, mail us your resume. Easy Services is currently seeking Food & Beverage Business Development Officers. Qualified applicants will have a degree in Science or Engineering. Extensive travel require]]> </description>
    </item>


    <item>
     <title> in chennai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/16787/Forms</link>
      <description><![CDATA[Business Development Officers


Do you have the desire and competitive spirit that goes with being the best? Are you an award-winning sales person who loves to get in the field and hunt for new business? Do your customers view you as a business partner who finds solutions that address challenges they face in their business? If so, mail us your resume. Easy Services is currently seeking Food & Beverage Business Development Officers. Qualified applicants will have a degree in Science or Engineering. Extensive travel require]]> </description>
    </item>


    <item>
     <title>medisnal chemistry And cheminformetics in india
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/16797/Forms</link>
      <description><![CDATA[medisnal chemistry And cheminformetics]]> </description>
    </item>


    <item>
     <title>Lead Researcher in Mountain View,CA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/16879/Forms</link>
      <description><![CDATA[RESPONSIBILITIES:
Develop, implement, and improve learning algorithms for optimizing internet advertising and website conversions. Recruit and a lead a team of researchers and software engineers. Invent novel algorithms and modify existing data-mining and learning algorithms for success in our domain. Evaluate, parameterize, and iterate models for success. Manage development of production quality model implementations. Understand business requirements and direct research appropriately. This is a player/coach role, expected to be somewhat more than 50% hands on.

We are building in-house software to support our own high volume, high uptime internet marketing applications.  Our systems need to make real time optimization decisions with partial data, support higher level decisions with reporting, track events with integrity, flexibly present content using a variety of technologies, and run reliably, even during upgrades.

REQUIREMENTS:
?Must have published in a related area. Please include CV with your application.
?Must have experience in the private sector applying learning and optimization techniques to business problems.
?Must have experience leading and coaching a team.
?Must have hands on coding experience at least in one language.
?Must be able to prove ideas and implement algorithms in working code.
?Must have experience developing and implementing models, not just training and using pre-existing coded models.
?Must have experience with parameter estimation/regression modeling.

EDUCATION:
PHD in Computer Science, Statistics, Robotics, Mathematics, Applied Mathematics, IR (information retrieval), AI (artificial intelligence), or similar related field.]]> </description>
    </item>


    <item>
     <title> in india,UK
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17105/Forms</link>
      <description><![CDATA[any suitable job for my qualification]]> </description>
    </item>


    <item>
     <title>sales in any
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17283/Forms</link>
      <description><![CDATA[a comany with a good sence of developement, a good potencial copoment company.]]> </description>
    </item>


    <item>
     <title>Consultant - Toxicology Scientific Director in Phoenix, Arizona
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17446/Forms</link>
      <description><![CDATA[TASC Laboratory Inc. is an established 25 year toxicology laboratory located in Phoenix, AZ  dedicated to urine drug of abuse testing. We are in search of a scientific director on a consultant basis. This position would require on site visits on a monthly basis only. We are very flexible as to the scheduling of the monthly visits. Telephonic consultation may be necessary on a limited basis. Listed below are the minimum qualifications required by C.A.P.

The scientific director of the drug testing laboratory is an individual with documented scientific qualifications comparable to those persons certified by the American Board of Forensic Toxicology or a PhD degree with certification in toxicological chemistry by the American Board of Clinical Chemistry. Alternative acceptable qualifications include an MD degree with certification in clinical and/or forensic pathology and at least two years of active laboratory experience in analytical toxicology.  All alternative qualifications also require documented training and/or experience with the forensic applications of analytical toxicology (such as court testimony, research, participation in continuing education programs, and review of publications.)

Interested parties may contact:
Gail French, General Laboratory Supervisor  gfrench@tascaz.org  OR
Douglas Kramer, Technical Laboratory Supervisor  dkramer@tascaz.org

Treatment Assessment Screening Center, Inc.
2234 N. 7th Street
Phoenix, Arizona 85006
Phone (602) 257-7588 Fax (602) 257-7590]]> </description>
    </item>


    <item>
     <title> in hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17461/Forms</link>
      <description><![CDATA[CURRICULUM VITAE

N.SIVA GANGI REDDY
E.W.S 408, ROAD NO :2,
K.P.H.B COLONY,
HYDERABAD,500072.
E-mail:  sivagreddy_n@yahoo.com
Cell:9949793022


CAREER OBJECTIVE:
To achieve a unique identity in the present competitive field and seeking a successful position. Intend to build a career with leading corporate of interactive environment with committed and dedicated people who will help me to explore myself fully and realize my potential.

EDUCATION QUALIFICATIONS

?	M.Sc in Chemistry from S.V.University collage, Tirupathi, with 65.25% in april 2005.
?	B.Sc (BBC) from Govt college for men ,Kadapa,(S.V.University) with 59.9% in march 2003.
?	INTERMEDIATE (BPC) from St joseph?s Junior college , kadapa, with 69.2% in march 1999.
?	SSC from Z.P.G.H.School, Payasampalli,with  69% in march 1997.


PERSONAL SKILLS


?	Comprehensive problem solving, excellent verbal and  written communication skills,
?	willing to work in teams, willingness to learn, addressing crowds and adaptability.
.
SOFTWARE SKILLS
?	Ms-Office (Ms-Word, Excel, Power Point)
?	Origin 5.0, Chem Window 4.5, Chem Draw 6.0 and ISIS draw 2.4
PERSONAL PROFILE

Name				:   N.SIVA GANGI REDDY
Date of Birth			:   10th June 1980
Nationality			:   Indian
Sex				:   Male
Marital status			:   Unmarried
Address for correspondence	:   Mammu siddu palli (V)
Pendlimarri(M)
Kadapa (D) (516216)

DECLARATION
I hereby declare that the above written particulars are true to the best of my knowledge and belief.
Place :
Date :
(N.SIVA GANGI REDDY)]]> </description>
    </item>


    <item>
     <title> in hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17462/Forms</link>
      <description><![CDATA[CURRICULUM VITAE

N.SIVA GANGI REDDY
E.W.S 408, ROAD NO :2,
K.P.H.B COLONY,
HYDERABAD,500072.
E-mail:  sivagreddy_n@yahoo.com
Cell:9949793022


CAREER OBJECTIVE:
To achieve a unique identity in the present competitive field and seeking a successful position. Intend to build a career with leading corporate of interactive environment with committed and dedicated people who will help me to explore myself fully and realize my potential.

EDUCATION QUALIFICATIONS

?	M.Sc in Chemistry from S.V.University collage, Tirupathi, with 65.25% in april 2005.
?	B.Sc (BBC) from Govt college for men ,Kadapa,(S.V.University) with 59.9% in march 2003.
?	INTERMEDIATE (BPC) from St joseph?s Junior college , kadapa, with 69.2% in march 1999.
?	SSC from Z.P.G.H.School, Payasampalli,with  69% in march 1997.


PERSONAL SKILLS


?	Comprehensive problem solving, excellent verbal and  written communication skills,
?	willing to work in teams, willingness to learn, addressing crowds and adaptability.
.
SOFTWARE SKILLS
?	Ms-Office (Ms-Word, Excel, Power Point)
?	Origin 5.0, Chem Window 4.5, Chem Draw 6.0 and ISIS draw 2.4
PERSONAL PROFILE

Name				:   N.SIVA GANGI REDDY
Date of Birth			:   10th June 1980
Nationality			:   Indian
Sex				:   Male
Marital status			:   Unmarried
Address for correspondence	:   Mammu siddu palli (V)
Pendlimarri(M)
Kadapa (D) (516216)

DECLARATION
I hereby declare that the above written particulars are true to the best of my knowledge and belief.
Place :
Date :
(N.SIVA GANGI REDDY)]]> </description>
    </item>


    <item>
     <title>RESEACH  ASSOCITE in HYDRABAD
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17504/Forms</link>
      <description><![CDATA[I HAVE    COMPLETED   BSC  WITH  CHEMISTRY    AND MSC  WITH  BIO CHEMISTRY
IHAVE  CAPABILITY  TO HANDLE  ANY EQUPEMENT IN MY RELATED  MY FILD . I HAVE EXPERENCE  IN PROTEN MODELING AND DRUG DESIGN]]> </description>
    </item>


    <item>
     <title>RESEACH  ASSOCITE in HYDRABAD
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17505/Forms</link>
      <description><![CDATA[I HAVE    COMPLETED   BSC  WITH  CHEMISTRY    AND MSC  WITH  BIO CHEMISTRY
IHAVE  CAPABILITY  TO HANDLE  ANY EQUPEMENT IN MY RELATED  MY FILD . I HAVE EXPERENCE  IN PROTEN MODELING AND DRUG DESIGN]]> </description>
    </item>


    <item>
     <title>RESEACH  ASSOCITE in HYDRABAD
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17507/Forms</link>
      <description><![CDATA[I HAVE  EXPEREINCE  IN PROTEN MODELING  DRUG  DESIGN]]> </description>
    </item>


    <item>
     <title>Molecular Simulation Scientist in Vancouver, British Columbia
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17581/Forms</link>
      <description><![CDATA[As a growing company, we are looking for exceptionally bright and motivated individuals who are eager to showcase their talent, experience and leadership in a team environment.  To learn more about the company, please visit our web site at www.zymeworks.com.

We are currently searching for an individual to be a major contributor to the development and maintenance of our core molecular simulation software platform.  The successful applicant for this position will start in March of 2007.

Required (Applicants will not be considered without the following skills)
?	Education: PhD in physics, chemistry, or a related field
?	Experience developing and using software for molecular dynamics and/or Monte Carlo simulations
?	Thorough understanding of molecular simulation algorithms
?	Experience using molecular simulations to study biological systems
?	Extensive development experience in the C programming language
?	Ability to communicate in the English language (spoken and written)

Further skills (The following skills are an asset to qualified applicants)
?	Doctoral and/or postdoctoral experience in molecular simulations (ab initio or classical)
?	Proficiency with the Linux operating system
?	Experience with perl, awk, shell and/or similar scripting languages
?	Experience working on a clustered computing environment
?	Experience using molecular modeling packages (AMBER, CHARMM, Gromacs, NAMD, etc)
?	Knowledge of good software development practice (version control, unit testing, profiling)

Duties:
?	Developing and implementing innovative ideas for rational protein design using molecular simulation software
?	Taking a lead role in the implementation of molecular simulation algorithms
?	Implementing new software features requested by internal end-users
?	Assisting in purchasing hardware and software for molecular simulations
?	Preparing patents and research publications
?	Attending conferences in the field of molecular simulations of biological systems

Salary and benefits are commensurate with experience and are highly competitive with industry standards.]]> </description>
    </item>


    <item>
     <title>Enzyme Engineer in Vancouver, British Columbia
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17582/Forms</link>
      <description><![CDATA[As a growing company, we are looking for exceptionally bright and motivated individuals who are eager to showcase their talent, experience and leadership in a team environment.  To learn more about the Company, please visit our web site at www.zymeworks.com.

Currently, we are seeking an enzyme engineer to take part in in silico enzyme modification projects and actively participate in the development and validation of our in-house molecular simulation software. The successful applicant for this position will start in March of 2007.

Required (Applicants will not be considered without the following skills)
?	Ph.D. in Molecular Biology or Biochemistry
?	Demonstrated experience in rational protein design or directed evolution
?	Thorough knowledge and practical experience of structural biology and enzyme mechanisms
?	Greater than 2 years of either industrial or academic post-graduate experience in a protein biochemistry-related field
?	Ability to communicate in the English language (spoken and written)

Further skills (The following skills are an asset to qualified applicants)
?	Familiarity with wet-lab techniques and processes for enzyme modification, expression, purification and biochemical characterization
?	Experience with homology modeling and docking software
?	Experience using molecular modeling and visualization packages (AMBER, CHARMM, VMD, Chimera, etc.)
?	Knowledge of the Linux operating system
?	Experience in one or more scripting languages (Perl, Tcl, etc.)
?	General understanding of the software development process
?	Should know about: AAGGAGAACGATCGTGAATGG

Duties:
?	Perform feasibility studies for proposed protein engineering projects
?	Propose and carryout internal projects for software validation
?	Write analysis tools in the perl and Tcl/Tk scripting languages
?	Closely interact with the software development team to improve and advance the functionality of our in-house modeling/analysis package
?	Assist in the selection of commercial software tools to supplement our in-house package
?	Participate in the preparation of patents and publications

Salary and benefits are commensurate with experience and are highly competitive with industry standards.

Due to the high volume of applicants, only candidates selected for an interview will be contacted.]]> </description>
    </item>


    <item>
     <title>biochemistry in singapore
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17658/Forms</link>
      <description><![CDATA[Respected Sir,

Sub : Application for the post of  LAB TECHNICIAN


I have finished my Msc biochemistry and diploma in medical lab technician with one years of experience in  munnas cytology and cancer screening at pondicherry.  I wish to apply for the said post as my experience meets the requirements and I have attached my resume for your kind persual.  I will be eager to get reply to this as soon as possible.

Thanking you


CURRICULUM VITAE

I. MOHAMED ALI                                                   D.D.MANSION
ROYAPETAH
CHENNAI
Cell: 9843309654
Ph: 04368 ? 226342
& nbsp;                                                                                                                                                                     ;                                                                                                               aleefy2k@yahoo.com

OBJECTIVE:



To strive and serve the community.
To become an indispensable part of any organization I work for.
To work for the growth and development of the organization with full
commitment.
Loyalty, sincerity and hard work.

SKILL SET:



Biomolecules
Metabolism
Clinical Biochemistry
Human Physiology
Cytology
Microbiology
Immunology
Pharamaceutical Chemistry
Biotechnology
Genetic Engineering

EDUCATION:



Master degree in Biochemistry.
From E.G.S.P.A.& S. College Nagapattinam, Tamil Nadu , India
Affiliated to Bharathidasan University , Trichirappalli, Tamil Nadu , India
Aggregate: 68.5%

Bachelor Degree in Biochemistry.
From T.B.M.L. College , Porayar, Tamil Nadu , India
Affiliated to Bharathidasan University , Trichirappalli, Tamil Nadu , India
Aggregate: 58.5%

Diploma in Medical Labaratory Technician.
From E.G.S. Pillay Medical institute.
Nagapattinam. (Tamil Nadu)

EXPERIENCE DETAILS:



1 year experience at KARAI LABS (X-ray ? ECG attached) Biopsy and Microbiology centre., Munnas cytology clinic and cancer screening. Karaikal-pondicherry

COMPUTER LITERACY:



ﾘ      Ms Office
ﾘ      Programming in ?C?

OTHERS:



ﾘ      Type writing (English) Passed in Lower.

SEMINAR DETAILS:



ﾘ      Paper presentation in Diabetes mellitus state level seminar at Trichy.

PROJECT DETAILS:



ﾘ      Title: Screening of Inborn Error in Metabolism

PERSONAL DETAILS:



Date of Birth                                         :           17-01-1982
Age                                                      :           23 Years
Father?s Name                                     :           Ibrahim
Gender                                                 :           Male
Marital Status                                       :           Single
Nationality                                            :           Indian
Religion                                                :           Islam
Languages Known                                :           English, Tamil (Read & Write)
Strength                                                :           Loyal, self belief and Hard Working


DECLARACTION

I hereby declare that the information and facts stated above are true and correct to the best of my knowledge and belief.
Signature


(I. MOHAMED ALI)]]> </description>
    </item>


    <item>
     <title>business analyst biotechnology in bangalore, india
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/17909/Forms</link>
      <description><![CDATA[i am a m.sc bioechnologist and have ahand ful of experience of 2and a half years in business development and also done expertise in various techniques.

presently working in a ciotech company in new delhi]]> </description>
    </item>


    <item>
     <title>Development Engineer in New Delhi
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18093/Forms</link>
      <description><![CDATA[Should be responsible for development of new product, improvement of existing product quality like Gas Chromatograph
, determining standard operating conditions, developing new test methods.

should be responsible for resource optimisation throught product upgradation in terms of
raw material reduction/alternatives, process simplifications and or yield imporvement.]]> </description>
    </item>


    <item>
     <title>Chemist - entry level in Garden Grove, CA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18143/Forms</link>
      <description><![CDATA[Are you a recent grad with a science degree in chemistry, biochemistry or biology (or equivalent)?  If so, we want to talk to you.

About the company:  The company makes store brand vitamins, minerals, supplements and over-the-counter drugs for America's top retailers.  We currently have multiple openings for entry-level and experienced chemists.]]> </description>
    </item>


    <item>
     <title>Scientist - Organic Chemistry in Singapore
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18287/Forms</link>
      <description><![CDATA[Scientist ? Organic Chemist


Our client is seeking an organic chemist to work with the current chemistry team to develop processes based on our biocatalysts.  Experience in synthetic organic chemistry and specifically in pharmaceutical process development is required.  Experience in the use of enzymes in the chemical synthesis would be an asset.



Responsibilities include:



Design and execution of experiments aimed at optimizing performance of developmental enzymes
Participation within a multi-disciplinary team of molecular biologists, biochemists and bioinformatics experts
Design and development of scalable processes to target molecules using bio-catalysis.
Synthesis of organic substrates
Preparation of lab samples for customers by agreed timelines
Development of written procedures and specifications for tech transfer to manufacturing partner


Qualifications required:



ｷ        PhD in Organic Chemistry with 2+ years experience or a MS in Organic Chemistry with 5+ years of industrial experience in synthetic organic chemistry and pharmaceutical process development.

ｷ        Chemical process research and development experience

ｷ        Critical thinking and attention to detail.

ｷ        Dedication to safe work practices

ｷ        Ability to multitask and produce quality results under tight timelines

ｷ        Ability to work within a multidisciplinary team

ｷ        Ability to work independently

ｷ        Persistence and creativity.

ｷ        Good oral and written communication skills





Interested, please submit your resume in MS Word format to: search@scientecsearch.com]]> </description>
    </item>


    <item>
     <title>Research Associate/Research Scientist in Hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/21391/Forms</link>
      <description><![CDATA[Min 4-5 yrs of exp. in Analytical Development Lab.  Should have handled GC, GCMS and HPLC.  Must possess good analytical data interpretation, trouble shooting and experiment planning skills.  Awareness of GLP and GMP and expertise in developing GC methods for low volatile fluorinated compounds will be an added advantage]]> </description>
    </item>


    <item>
     <title>postdoctoral research associate in CECF, Faculty of Pharmacy, University of Lisbon
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/21401/Forms</link>
      <description><![CDATA[The Faculty of Pharmacy at the University of Lisbon and the Research Center in Pharmaceutical Sciences (CECF) are seeking two postdoctoral research associates to work in medicinal chemistry projects on the design and synthesis of novel molecules directed towards several key therapeutic targets related to neurodegenerative diseases. Candidates must have a PhD in Chemistry or a closely related area and significant post-doctoral research experience in organic synthesis in the context of medicinal chemistry projects and ideally have some experience in biological evaluation. The successful applicants will be expected to maintain an externally funded research program within the Medicinal Chemistry Division. The appointees will also play a major role in the organisation and running of the medicinal chemistry laboratory, including assisting with supervision of PhD students.]]> </description>
    </item>


    <item>
     <title>postdoctoral research associate in CECF, Faculty of Pharmacy, University of Lisbon
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/21402/Forms</link>
      <description><![CDATA[We are seeking one postdoctoral research associate to work in medicinal chemistry projects on the design of novel molecules directed towards several key therapeutic targets. Applicants should have a PhD in Chemistry or a closely related area and significant post-doctoral research experience  is an equal opportunity employer and actively seeks diversity among its employees.in computational chemistry in the context of medicinal chemistry projects and ideally have some experience in biological evaluation. The position requires good oral and written communication skills and offers the opportunity to carry out basic scientific research within a highly motivated and productive team.
The successful applicants will be expected to maintain an externally funded research program within the Medicinal Chemistry Division. The appointees will also play a major role in the organisation and running of the molecular modelling laboratory, including assisting with supervision of PhD students.


Experience
The ideal candidate should have a Ph.D. in chemistry, pharmacy, or related fields with a strong background in physical chemistry and at least three years of postdoctoral experience.
Successful applicants will have experience in molecular simulation and standard molecular mechanics software packages such as Amber, CHARMM, Gaussian, Gromacs, or NAMD. Practical knowledge of ligand-based modelling techniques is an advantage.
Strong computational skills are desired including scientific programming experience and experience with UNIX environments.
An ideal candidate would be highly competent in a number of programming and scripting languages such as C++, FORTRAN, perl, and python.  Candidate must also display exceptional motivation and the ability and desire to work both independently and as part of a team and show an active interest in medicinal chemistry. Good oral and written communication skills are essential.]]> </description>
    </item>


    <item>
     <title>Chemistry Lead/Manager - Process Chemistry in Singapore
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18288/Forms</link>
      <description><![CDATA[Chemistry Lead (Base in Singapore)



The incumbent is responsible for providing scientific leadership and management of the Chemistry Department in support of Client?s development of highly efficient processes to pharmaceuticals.



Job Responsibilities



Key Responsibilities include but are not limited to:

Providing scientific leadership and management of Chemistry Group, which works as part of larger multi-disciplinary Project teams.  Additional functions include coordination of efforts with Operations and external CROs' to meet Project objectives and timelines.
Leading growth of Chemistry team through recruitment of scientific staff.
Participating in design and execution of efficient routes to chemical targets, optimization of process steps
Participating in design of experiments aimed at optimizing performance of developmental enzymes.
Managing internal synthesis projects as well as synthesis projects contracted to external parties.
Managing departmental resources and budgets to meet project timelines.
Establishing departmental organizational structure, supervisory relationships, and operating policies.
Performing range of supervisory activities including review of salaries, schedules, and performance.
Mentoring departmental staff and supporting development of career paths and professional growth.


Requirements/Qualifications



PhD in Synthetic Organic Chemistry or Biocatalysis, or a related field, plus minimum of 5 years of pharmaceutical chemical development or process development experience.
Strong working knowledge and practical experience in synthetic organic chemistry and pharmaceutical process research and development, and methods of scientific investigation.
Able to recruit and retain highly qualified scientists for department.
Able to perform effectively and execute independently a wide variety of assignments of both a scientific and business nature.
Required to have the ability to manage multiple groups, effectively coordinating their efforts to advance a product or process of major significance to the company.
Expected to advance new ideas or initiate the introduction of new technology to advance Project goals.
Expected to make pivotal contributions to process research and development and technology development.
Strong problem-solving skills and track record of successful management and leadership of projects and/or teams within an interdisciplinary environment.
Has made fundamental contributions to the development and implementation of routes to API's, process improvements or scientific processes of major significance, including the introduction of novel methodology.
Superior verbal and written communication skills, including presentations, negotiations, and scientific correspondence.
Writing should require little or no external editing.  Excellent observational, organizational, data management and documentation skills.


Interested applicants, please submit your resume in MS Word format to: search@scientecsearch.com]]> </description>
    </item>


    <item>
     <title>Research Associate Chemistry in South San Francisco
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18310/Forms</link>
      <description><![CDATA[The department of Medicinal Chemistry is focused on identifying small molecule
pharmaceuticals to complement Genentech?s Oncology franchise. The Computational
Chemistry group (within Medicinal Chemistry) applies computational methods to facilitate
the rapid advancement of our small molecule programs, including structure-function data
analysis, receptor-based and/or ligand-based design and screening library compound
selection. The group also develops tools to facilitate access to our small molecule
corporate database.

Responsibilities:
The successful candidate will be well versed in aspects of structure-based drug design and
/ or ligand-based design approaches. Responsibilities will include: selection or design of
compounds for HTS libraries; rapid analysis of primary HTS data and identification of
compounds for additional investigation; structure-based lead optimization; correlation of
ligand structure with function or physicochemical properties (potentially involving
multivariate data analysis); generation and maintenance of 3D conformational data for
commercially available compounds to be used for pharmacophore mining.
The candidate will work in close collaboration with research chemists to develop and use
predictive models of the structure-activity relationships, hence good communication skills
(written and oral) are essential.

Requirements
A BS/MS degree is required along with a minimum of 4 years computational chemistry
experience. Knowledge of organic chemistry and the use of structure-based and
cheminformatics approaches to drug discovery is highly desirable. Experience with
medicinal chemistry software tools (Schrodinger, Accelrys, SciTegic Pipeline Pilot, Spotfire,
ISIS host/base, Daylight), is advantageous. Additionally, a proven ability to work in close
conjunction with other research scientists and programmers is expected.]]> </description>
    </item>


    <item>
     <title>Research Computational Chemist in Vicksburg, MS, USA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18320/Forms</link>
      <description><![CDATA[Opportunities in computational chemistry are available with the US Army ERDC Computational Chemistry Team. Cuurent research topics include following competing transformation mechanisms and rates of transformation for nitroaromatic energetic compounds, cyclic and cage cyclic nitramine compounds as well as emerging compounds of Army and DoD interest.  The new team member will be expected to 1) Perform computational chemistry and spectroscopic verification; 2) Participate in writing proposals and publications, including peer reviewed journal articles and technical bulletins/reports; 3)Collaborate with scientists on projects pertaining to the Army mission within and outside ERDC.

Knowledge of or experience with UV, Vis, FTIR and HPLC spectroscopic techniques, as well as knowledge of or experience with NMR and MS methods are desirable.

Recruiting incentives may apply in specific cases.

MUST be US citizen.]]> </description>
    </item>


    <item>
     <title> in none
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18338/Forms</link>
      <description><![CDATA[none.. im a final year student of B.Tech biotechnology.]]> </description>
    </item>


    <item>
     <title> in none
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18339/Forms</link>
      <description><![CDATA[none.. im a final year student of B.Tech biotecnology.. i dnt have any experience.. but i have hands on experience in my field]]> </description>
    </item>


    <item>
     <title> in none
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18340/Forms</link>
      <description><![CDATA[none]]> </description>
    </item>


    <item>
     <title>Analytical Chemist in Dubai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18699/Forms</link>
      <description><![CDATA[A Leading Commertial Testing lab ,looking for an Analytical chemist with GC or GC/MS Experience]]> </description>
    </item>


    <item>
     <title>Principle Scientist in Wallingford, CT
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/1874/Forms</link>
      <description><![CDATA[MAJOR SKILLS REQUIRED: A variety of application development tools
such as C++, C#, Python/Perl data mining technology,  strong
analytical and scientific skills.  Background in computational
chemistry, statistics, computer science.  Strong background in
some set of statistics, image analysis or similar such as pattern
recognition, novel database design and data mining or equivalent
experience in a scientific discipline.

RESPONSIBILITIES REQUIRED:  Ensure that best in class tools for
hit identification are applied to the HTS data produced by New
Leads Biology.  Work with biologists, computational chemists,
chemists, statisticians and vendors to develop appropriate
methodologies and tools for hit assessment and ensure that these
tools are applied on a routine basis.  Work with New Leads
Biologists and Chemists to assemble the data sets and supervise
running of the analyses, and report the results for
interpretation by the hit teams.   Similarly ensure availability
of tools for the evaluation of the quality of the HTS data to
eliminate erroneous and false positive data by using data mining,
visualization and statistical techniques and run analyses as
needed.  As with the cheminformatics tools ensure that these QC
tools are applied routinely and are broadly available.    Use
experience in running analyses to develop applications to support
screen quality and hit assessment.  Contribute to the design and
development of HTS Tool set, with an emphasis on down stream
analysis.  Work with Cheminformatics experts to evaluate new
tools as appropriate.  Develop standard data sets for testing of
new tools and products.

POSITION: ChemoInformatics/Programer/Dataminer

EDUCATION PREFERRED:   PhD or strong MS in Biology/Chemistry with
strong informatics skills.

YEARS OF EXPERIENCE PREFERRED:  2+ years post-PhD, 5+ years
post-MS.]]> </description>
    </item>


    <item>
     <title>Manager- Computational Chemist in India - Banglore
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18763/Forms</link>
      <description><![CDATA[Educational Qualification: PhD in a relevant field such as Computational, Physical, or Theoretical Chemistry; Molecular Biophysics; Computational Biology.

Background Experience: The candidate will have had post-doctoral experience at minimum at a world-class university or research institution.

Core Skills / Competency: Though an in-depth knowledge of the computation of protein-ligand binding free energies, molecular dynamics and/or Monte Carlo simulations of biomolecular systems, application of statistical mechanics to biomolecular systems, free energy perturbation methods, and methods for speeding up evaluation of electrostatic energies is highly desirable, specific knowledge of any of these areas is less critical than exceptional intellectual ability and a demonstrated track record of achievement.

Two especially important criteria for these candidates are that they (a) have a strong publication record and (b) are familiar with and interested in primarily computational methods (we do not currently have wet-lab facilities).

Detailed Responsibilities: The manager will perform hands-on technical research such as setting up, running and analyzing molecular dynamics simulations on our supercomputers (currently a large general purpose cluster, and in the future, specialized hardware). His/her responsibilities would also include recruiting and training up a new team of computational chemists (mainly fresh top graduates of top universities), ensuring that the team functions effectively, and most importantly communicating and coordinating with the US?based team on a daily basis regarding scientific research.

Personal Characteristics: Successful hires will have strong oral and written communications skills, demonstrated good leadership skills, exceptional intellectual ability, and excellent track record of academic and professional performance.]]> </description>
    </item>


    <item>
     <title>Computational Chemistry Contractor (with option to hire) in West Chester
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18765/Forms</link>
      <description><![CDATA[Term

6+ months with the right to hire

Education

College graduate, Technical certifications a plus
Years Experience:

Minimum 4 years experience in Pharmaceutical / Biotech environment
Minimum 6 years IT experience
Skillset

Excellent written and verbal communication skills
Experience supporting computational chemistry organization
Linux/Unix system administration
Experience with the following software applications/packages
Schrodinger Suite
Tripos Suite
Pipeline Pilot
Basic Shell scripting
FlexLM licensing
Windows and Linux integration (SAMBA)
Strong problem resolution skills
Major Responsibilities

Document existing environment and processes
Design and implementation of new computational platforms
General support for existing computational chemistry platform
Lead future projects for computational group
Document user requirements
Design and implement test plans]]> </description>
    </item>


    <item>
     <title>R&D Director of Biochemical Experiements ? ENG205 in Florida
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18795/Forms</link>
      <description><![CDATA[EXECUTIVE OFFICE SERVICES
Human Resources Consultants

POSITION:
R&D Director of Biochemical Experiements ? ENG205

EMPLOYER:
A well-funded start-up organization that has a patented process for the conversion of sunlight to petrochemical products.

LOCATION:
Florida

CAREER OPPORTUNITY:
R & D - Director of Biochemical
Seeking a Sr. Engineering R&D Director to work within a well-funded start-up organization who has a patented process for the conversion of sunlight to petrochemical products. The ideal individual will have significant experimental design and program management experience and preferably a background in algae cultivation. This position will be instrumental in developing solutions to maximize algae growth rates and algae oil yields under a wide range of environmental conditions and will report directly to the CTO .  In addition, this individual will be responsible for building and managing a group of high-caliber scientists and engineers.
- Extensive experience developing, planning, and implementing various experiments and statistical testing
- At least some knowledge of aquaculture and algae
- Proven people & leadership skills.
- Provide design input to the process engineers based upon test results and financial impacts.

QUALIFICATIONS:
Primary Skills Required:  Biological testing, experiment design, statistics, project management
Secondary Skills:  Algae cultivation
MS required in Chemical Engineering or Biochemistry or related field, PhD preferred
Multi-disciplinary technical and engineering experience, with strong knowledge of process engineering and biological (including sterile) experimental protocols
Minimum of 10 years laboratory and experiment and field design experience
Capable of working in a highly entrepreneurial, unstructured, fast paced environment.
SALARY:  $90,000 ? 120,000 & Bonue & Equity
Send resumes email to:
Executive Office Services. CAREERS@EXESERVICE.BIZ
Phone: (510) 830-9721

Executive Office Services is an Executive Recruiting Consultant Enterprise dedicated to helping professionals in furthering their career goals.  Success is attributed to the personalized service, with the goal of bringing together qualified business professional with quality companies.  We have a variety of opportunities available.  If you are looking for an Executive Human Resources Consultant please feel free to contact:.
Executive Office Services. CAREERS@EXESERVICE.BIZ
Phone: (510) 830-9721

Due to the high volume of resumes received daily from candidates responding to positions nationwide, you may not be contacted immediately.  If you are not contacted within 7 business days, we may not have a position meeting your expertise or the position you applied for has been staffed.  Should that be the case, we will place your resume in our keyword searchable database.  In the event an opportunity becomes available which requires a professional with your expertise, a representative will contact you, regarding your availability and interest in the position.]]> </description>
    </item>


    <item>
     <title>Working in Research And development in Thane(mumbai)
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18848/Forms</link>
      <description><![CDATA[I am working in four year in R&D .I have good knowledge about Chemistry .

RESUME

MR. HONRAO IRGONDA APPASO
(M.Sc Polymer Chemistry)
OFFICER R&D, MNC
irgondahonrao@yahoo.com

?	OBJECTIVE: Hard Work is my way towards success. To excel in career considering all the assignment as a Challenge environment where there is scope for upgrading my skill and Knowledge and where I can take active part in the growth of the organization

?	WORK EXPERIENCE

?	CURRENT EXPERIENCE

ORGANIZATION:	UNITED PHOSPHOROUS LTD (THANE, MUMBAI)

DURATION:		15th Sept 2004 Till Date

DESIGNATION:	OFFICER R&D

DEPARTMENT:	SYNTHESIS

PRODUCT:		AGROCHEMICAL

RESPONSIBILITY:	1) Synthesis the product
2) Technology Transfer R & D to Pilot Plant
3) Preparation of Impurity
4) Preparation of Raw Material
5) Handling of Homogeneus &hetrogeneus catalysis
6)De hydrogenation Allipatic Compounds.
7) Azotropic distillation.
8)Preperation of Homogeneous Chiral Catalysis.
9) Process  development for continues reaction.
10)Oxidation reaction reaction.
11)Reduction .
12)Bromination .
13)Condensation reaction.
14)Handling fix bed reactor.for Dehydrogenation.
15)Route selection for reaction  Suitable for low cost.
16) Carry out Literature search.
17)Handling high pressure reactor.
18)Synthesis and optimization of new chemical  entities.
19)Responsible for research activity in lab.
20)Research and process development activity for new molecules.
21)Process Scale up and pilot plant studies.
22)Self  Starter.
23)Technical leader in their discipline.
24) Working in a team invironment.
25)Ability to travael local and internationally.

WORK EXPERT:       1) Hydrogenation of  Imine by using Chiral Catalysis.
2) Chlorination Aromatic and Alliphatic compounds.
3)Work independently .
Training Attend:          1)Safty Training .
2)Aspen tech Softwar Training attend.
3)GC and HPLC training .
4) Security of R&D information .

Total number of projects handled: 15 (Till Date)

?	PREVIOUS EXPERIENCE

?	ORGANIZATION:	ELKAY SILICON POLYMER. PVT. LTD  (PUNE)

DURATION:		20 May 2003 To 1 March 2004

DESIGNATION:	TRAINEE (Quality Control Chemist)

DEPARTMENT:	QUALITY CONTROL
RESPONSIBILITY:	1) To determine Viscosity of polymer by using
Brookfield Viscometer
2) To determine Volatile Content &Solid Content
3) To determine refractive index of polymer
4) To determine Clarity of polymer
5) To determine Acid Value

PRODUCT:                  SILICON OIL
OTHER INSTRUMENTS HANDLED IN THE COMPANY
1)      Infra-red (IR) Spectroscopy
2)      Differential Scanning  Calorimeter
3)      Thermo gravimetric  Analysis
4)      Polymer Characterization
5)      UV  Spectroscopy
6)      Premier  Color scan(Color matching)
7)      Gas  Chromatography
8)      Karl-Fisher	ORGANIZATION:
GRATEX   INDUSTRIES   LIMITED

DESIGNATION            PRODUCTION-SUPERVISOR
DURATION                  3 Months
RESPONSIBILITY      1) Quality Control
2)  Color  Matching
3)  Work Management
PRODUCT                   WALL   PAPER
?	EDUCATIONAL QUALIFICATION

Master  of Science  in Polymer Chemistry  in 2003
From Shivaji University, Kolhapur
Grade-First  Class With 63%

Bachelor of Science in Chemistry in 2000
From Willingdon College, Sangli
Shivaji University ,Kolhapur
Grade-First  Class 60%

?	COMPUTER  KNOWLEDGE: Basic Computer Knowledge

?	PERSONAL  INFORMATION

NAME                                       Honrao   Irgonda    Appaso

BIRTH DATE                           07/06/1979

PRESENT ADDRESS 	  Laxmi park Phase-1,
C-2
Room No.404   ,
Pada no-2
Lokmanyanagar .
THANE(W)

PERMANENT ADDRESS	   A/P  Chabukswar ?wadi (salagre)
Tal- Miraj    Dist ?Sangli
E-MAIL ADDRESS                irgondahonrao@yahoo.com
SEX                                           Male
MARITAL STATUS               Single
NATIONALITY                      INDIAN
PHONE NUMBER                  09819651766




DATE                                                                                                   SIGNATURE]]> </description>
    </item>


    <item>
     <title>Junier Chemist in Thane(Mumabi)
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18849/Forms</link>
      <description><![CDATA[RESUME

MR. HONRAO IRGONDA APPASO
(M.Sc Polymer Chemistry)
OFFICER R&D, MNC
irgondahonrao@yahoo.com

?	OBJECTIVE: Hard Work is my way towards success. To excel in career considering all the assignment as a Challenge environment where there is scope for upgrading my skill and Knowledge and where I can take active part in the growth of the organization

?	WORK EXPERIENCE

?	CURRENT EXPERIENCE

ORGANIZATION:	UNITED PHOSPHOROUS LTD (THANE, MUMBAI)

DURATION:		15th Sept 2004 Till Date

DESIGNATION:	OFFICER R&D

DEPARTMENT:	SYNTHESIS

PRODUCT:		AGROCHEMICAL

RESPONSIBILITY:	1) Synthesis the product
2) Technology Transfer R & D to Pilot Plant
3) Preparation of Impurity
4) Preparation of Raw Material
5) Handling of Homogeneus &hetrogeneus catalysis
6)De hydrogenation Allipatic Compounds.
7) Azotropic distillation.
8)Preperation of Homogeneous Chiral Catalysis.
9) Process  development for continues reaction.
10)Oxidation reaction reaction.
11)Reduction .
12)Bromination .
13)Condensation reaction.
14)Handling fix bed reactor.for Dehydrogenation.
15)Route selection for reaction  Suitable for low cost.
16) Carry out Literature search.
17)Handling high pressure reactor.
18)Synthesis and optimization of new chemical  entities.
19)Responsible for research activity in lab.
20)Research and process development activity for new molecules.
21)Process Scale up and pilot plant studies.
22)Self  Starter.
23)Technical leader in their discipline.
24) Working in a team invironment.
25)Ability to travael local and internationally.

WORK EXPERT:       1) Hydrogenation of  Imine by using Chiral Catalysis.
2) Chlorination Aromatic and Alliphatic compounds.
3)Work independently .
Training Attend:          1)Safty Training .
2)Aspen tech Softwar Training attend.
3)GC and HPLC training .
4) Security of R&D information .

Total number of projects handled: 15 (Till Date)

?	PREVIOUS EXPERIENCE

?	ORGANIZATION:	ELKAY SILICON POLYMER. PVT. LTD  (PUNE)

DURATION:		20 May 2003 To 1 March 2004

DESIGNATION:	TRAINEE (Quality Control Chemist)

DEPARTMENT:	QUALITY CONTROL
RESPONSIBILITY:	1) To determine Viscosity of polymer by using
Brookfield Viscometer
2) To determine Volatile Content &Solid Content
3) To determine refractive index of polymer
4) To determine Clarity of polymer
5) To determine Acid Value

PRODUCT:                  SILICON OIL
OTHER INSTRUMENTS HANDLED IN THE COMPANY
1)      Infra-red (IR) Spectroscopy
2)      Differential Scanning  Calorimeter
3)      Thermo gravimetric  Analysis
4)      Polymer Characterization
5)      UV  Spectroscopy
6)      Premier  Color scan(Color matching)
7)      Gas  Chromatography
8)      Karl-Fisher	ORGANIZATION:
GRATEX   INDUSTRIES   LIMITED

DESIGNATION            PRODUCTION-SUPERVISOR
DURATION                  3 Months
RESPONSIBILITY      1) Quality Control
2)  Color  Matching
3)  Work Management
PRODUCT                   WALL   PAPER
?	EDUCATIONAL QUALIFICATION

Master  of Science  in Polymer Chemistry  in 2003
From Shivaji University, Kolhapur
Grade-First  Class With 63%

Bachelor of Science in Chemistry in 2000
From Willingdon College, Sangli
Shivaji University ,Kolhapur
Grade-First  Class 60%

?	COMPUTER  KNOWLEDGE: Basic Computer Knowledge

?	PERSONAL  INFORMATION

NAME                                       Honrao   Irgonda    Appaso

BIRTH DATE                           07/06/1979

PRESENT ADDRESS 	  Laxmi park Phase-1,
C-2
Room No.404   ,
Pada no-2
Lokmanyanagar .
THANE(W)

PERMANENT ADDRESS	   A/P  Chabukswar ?wadi (salagre)
Tal- Miraj    Dist ?Sangli
E-MAIL ADDRESS                irgondahonrao@yahoo.com
SEX                                           Male
MARITAL STATUS               Single
NATIONALITY                      INDIAN
PHONE NUMBER                  09819651766




DATE                                                                                                   SIGNATURE]]> </description>
    </item>


    <item>
     <title>Researcg R&D in Thane(Mumbai)
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18851/Forms</link>
      <description><![CDATA[RESUME

MR. HONRAO IRGONDA APPASO
(M.Sc Polymer Chemistry)
OFFICER R&D, MNC
irgondahonrao@yahoo.com

?	OBJECTIVE: Hard Work is my way towards success. To excel in career considering all the assignment as a Challenge environment where there is scope for upgrading my skill and Knowledge and where I can take active part in the growth of the organization

?	WORK EXPERIENCE

?	CURRENT EXPERIENCE

ORGANIZATION:	UNITED PHOSPHOROUS LTD (THANE, MUMBAI)

DURATION:		15th Sept 2004 Till Date

DESIGNATION:	OFFICER R&D

DEPARTMENT:	SYNTHESIS

PRODUCT:		AGROCHEMICAL

RESPONSIBILITY:	1) Synthesis the product
2) Technology Transfer R & D to Pilot Plant
3) Preparation of Impurity
4) Preparation of Raw Material
5) Handling of Homogeneus &hetrogeneus catalysis
6)De hydrogenation Allipatic Compounds.
7) Azotropic distillation.
8)Preperation of Homogeneous Chiral Catalysis.
9) Process  development for continues reaction.
10)Oxidation reaction reaction.
11)Reduction .
12)Bromination .
13)Condensation reaction.
14)Handling fix bed reactor.for Dehydrogenation.
15)Route selection for reaction  Suitable for low cost.
16) Carry out Literature search.
17)Handling high pressure reactor.
18)Synthesis and optimization of new chemical  entities.
19)Responsible for research activity in lab.
20)Research and process development activity for new molecules.
21)Process Scale up and pilot plant studies.
22)Self  Starter.
23)Technical leader in their discipline.
24) Working in a team invironment.
25)Ability to travael local and internationally.

WORK EXPERT:       1) Hydrogenation of  Imine by using Chiral Catalysis.
2) Chlorination Aromatic and Alliphatic compounds.
3)Work independently .
Training Attend:          1)Safty Training .
2)Aspen tech Softwar Training attend.
3)GC and HPLC training .
4) Security of R&D information .

Total number of projects handled: 15 (Till Date)

?	PREVIOUS EXPERIENCE

?	ORGANIZATION:	ELKAY SILICON POLYMER. PVT. LTD  (PUNE)

DURATION:		20 May 2003 To 1 March 2004

DESIGNATION:	TRAINEE (Quality Control Chemist)

DEPARTMENT:	QUALITY CONTROL
RESPONSIBILITY:	1) To determine Viscosity of polymer by using
Brookfield Viscometer
2) To determine Volatile Content &Solid Content
3) To determine refractive index of polymer
4) To determine Clarity of polymer
5) To determine Acid Value

PRODUCT:                  SILICON OIL
OTHER INSTRUMENTS HANDLED IN THE COMPANY
1)      Infra-red (IR) Spectroscopy
2)      Differential Scanning  Calorimeter
3)      Thermo gravimetric  Analysis
4)      Polymer Characterization
5)      UV  Spectroscopy
6)      Premier  Color scan(Color matching)
7)      Gas  Chromatography
8)      Karl-Fisher	ORGANIZATION:
GRATEX   INDUSTRIES   LIMITED

DESIGNATION            PRODUCTION-SUPERVISOR
DURATION                  3 Months
RESPONSIBILITY      1) Quality Control
2)  Color  Matching
3)  Work Management
PRODUCT                   WALL   PAPER
?	EDUCATIONAL QUALIFICATION

Master  of Science  in Polymer Chemistry  in 2003
From Shivaji University, Kolhapur
Grade-First  Class With 63%

Bachelor of Science in Chemistry in 2000
From Willingdon College, Sangli
Shivaji University ,Kolhapur
Grade-First  Class 60%

?	COMPUTER  KNOWLEDGE: Basic Computer Knowledge

?	PERSONAL  INFORMATION

NAME                                       Honrao   Irgonda    Appaso

BIRTH DATE                           07/06/1979

PRESENT ADDRESS 	  Laxmi park Phase-1,
C-2
Room No.404   ,
Pada no-2
Lokmanyanagar .
THANE(W)

PERMANENT ADDRESS	   A/P  Chabukswar ?wadi (salagre)
Tal- Miraj    Dist ?Sangli
E-MAIL ADDRESS                irgondahonrao@yahoo.com
SEX                                           Male
MARITAL STATUS               Single
NATIONALITY                      INDIAN
PHONE NUMBER                  09819651766




DATE                                                                                                   SIGNATURE]]> </description>
    </item>


    <item>
     <title>Sr. Scientist - Medicinal Chemistry/Organic Synthesis in Bay Area, CA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/18852/Forms</link>
      <description><![CDATA[Job Requirements:

-Ph.D. in Synthetic Chemistry or Medicinal Chemistry
-Strong background in organic synthesis
-Industry experience in medicinal chemistry for drug discovery & development ? 4 years minimum
-Creative approaches to problem solving & design of experiments


Job Description:

-Responsible for conducting scientific research for the discovery of drugs & the development of drug candidates
-Identify and validate targets
-Develop cutting edge techniques to isolate characterize, purify and produce substances, reagents, assays and tools for use in other research projects.
-Plans, designs, implements and analyzes laboratory experimentation to expand knowledge of drug substances or to identify drug substances.
-Participates in development of patent applications.
-Participates in group meetings.
-Publish in scientific journals and present research at conferences when appropriate]]> </description>
    </item>


    <item>
     <title>trainee chemist in any where in india
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/19021/Forms</link>
      <description><![CDATA[pharmaceutical]]> </description>
    </item>


    <item>
     <title>Senior Pharmacologist in Pune / Hyderabad, India
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/19096/Forms</link>
      <description><![CDATA[Designation :    Senior Pharmacologist
Grade    :  Managerial Cadre
Work Place :  Initially will be based at Pune. Should be willing to relocate to Hyd after 6-8 months.

Job Description :  In vivo Pharmacology
Team leaders for setting up of mechanistic and disease specific in vivo animal models in rodents and large animals. Hands on experience of developing appropriate animal models for drug discovery program or for safety pharmacology studies for NCEs, interpretation of data and familiarity with ethical consideration while using animals for research would be essential.

Qualification: Ph.D. or Masters in Pharmacology/ veterinary sciences or related sciences
Experience :   more than 5 years of relevant experience in pharmaceutical industries.
Salary Range :   As per the industry standards.]]> </description>
    </item>


    <item>
     <title>R&D and QC in bangalore,hosur, chennai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/19128/Forms</link>
      <description><![CDATA[synthesis of organic chemistry]]> </description>
    </item>


    <item>
     <title>RESEARCH ASSOCIATE in BANGALORE
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/19172/Forms</link>
      <description><![CDATA[MEDICINAL CHEMISTRY ACTIVITIES.]]> </description>
    </item>


    <item>
     <title>biochemist in switerland
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/19212/Forms</link>
      <description><![CDATA[Application Specialist in Diagnostic industry]]> </description>
    </item>


    <item>
     <title>Medicinal chemist in hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/19228/Forms</link>
      <description><![CDATA[Medicinal chemist]]> </description>
    </item>


    <item>
     <title>computational chemist in bangalore ,india
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/1923/Forms</link>
      <description><![CDATA[Computational Modelling profiles - PH D's with experience on working on Tripos and accelyrs s/w.As also PhD's with  computational chemistry experience(3 to 5 years)]]> </description>
    </item>


    <item>
     <title> in Wareham, MA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22167/Forms</link>
      <description><![CDATA[The Manager of Environmental Fate and Metabolism assumes a wide range of scientific and technical duties associated with various animal, aquatic, plant and soil environmental fate and metabolism projects performed at Springborn Smithers Laboratories.  Responsible for the training and supervision of the professional and technical staff, including reviews, promotions, and accounting of time worked.  The Manager of Environmental Fate and Metabolism is responsible to enhance the performance of the scientific team and its individuals by developing and instituting novel approaches to animal, aquatic, plant and soil environmental fate and metabolism, problem-solving and the development and maintenance of customer relations leading to new business opportunities.  The Manager will effectively communicate and collaborate with peers regarding study schedules, study conduct and new technologies.  Duties include training scientific staff, managing maintenance and calibration of laboratory equipment, reviewing and summarizing data, problem solving, technical and business communications with peers and customers.]]> </description>
    </item>


    <item>
     <title>Software Programmer/Architect-Tnk-ISTL in Bangalore, India
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22203/Forms</link>
      <description><![CDATA[Design and development of the Processor Architecture validation tools.Job involved design of the tool involving proprietary operating system at the system programming level. These tools are used to bringup & test new processor and processor based System. Candidate will be working on the Advanced multi-core processor architecture based systems. Work will involve understanding processor architecture, developing algorithm to validate processor( and system) efficiently.]]> </description>
    </item>


    <item>
     <title>GUI Developer-IBM-ISL in Bangalore
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22204/Forms</link>
      <description><![CDATA[Design, code and test user interfaces and graphical user interfaces in a electronic design automation application.  Also develop high speed 2D graphical renderings of circuit designs.  Good communication skills are required to interact with the applications users and to be able to design the user interfaces in a consistent and user friendly manner.   Program on AIX and Linux based workstations in the latest programming languages including C/C++, Tcl/Tk, Motif X11 and Qt.]]> </description>
    </item>


    <item>
     <title>Computational Lithogrpahy-IBM-ISL in Bangalore
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22205/Forms</link>
      <description><![CDATA["Dataprep Engineer - This job can encompass several potentential roles (listed below). As experience is gained, an emplyeee will increase their scope to include additonal roles, or possibly move to a new role. Likely initial roles would be Boolean developer, and/or Infrastructure developer (depending on the skills of the candidate).  Layout Test Engineer - In this role the person is expected to have basic layout editing skills on an industry standard layout editing tools.  In this role the engineer is expected to have the creative ability to generate unique test patterns given a set of requirements and later be able to generate an array of test structures which are comprehensive to create a unique test suite of all patterns in the domain of physical verification in particular RET technologies.
Knowledge of ground rules, exposure to memory cell designs, microprocessor design is a big plus.
"]]> </description>
    </item>


    <item>
     <title>biochemistry in delhi
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22208/Forms</link>
      <description><![CDATA[as scientist offiser1]]> </description>
    </item>


    <item>
     <title>job in dubai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22232/Forms</link>
      <description><![CDATA[stuff]]> </description>
    </item>


    <item>
     <title>R&D Manager (FTE) in Bay Area CA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22249/Forms</link>
      <description><![CDATA[Position: R&D Manager

Department: R&D

Location: Bay Area (San Jose)




The following is not intended to represent an all-inclusive list of job responsibilities, but to outline the ESSENTIAL FUNCTIONS of the position.





General Description:

Responsible for primary hiring, on-time performance appraisals, coaching/counseling, employee development and necessary communications to regarding performance issues.





Essential Functions:

ｷPlans, organizes, staffs, directs and controls the engineering function within appropriate guidelines, policies and regulations.

ｷEstablishes and guides goals and accomplishments of the team/department.

ｷResponsible for primary hiring, on-time performance appraisals, coaching/counseling, employee development and necessary communications to regarding performance issues.

ｷMaintains the timeliness of the engineering schedule to insure effective administration of time standard practices.

ｷEnsures compliance with all regulatory and compliance activities within prescribed area.

ｷDevelops annual budget, status reports and other related communications.

ｷOperates within budget and organizations guidelines and philosophy by implementing cost reduction programs through value analysis.

ｷLeads special engineering or related discipline projects/assignments.

ｷProvides technical expertise to engineers in the area of failure modes, failure analysis, and test requirements.

ｷPlans and coordinates with other engineering areas to ensure the timely and efficient product production.

ｷAssist the VP of R&D in overall management of the department as assigned.

ｷWorks as a key member of an interdisciplinary business team to drive business performance.

ｷAccountable for all record-keeping as appropriate and in accordance with the company's specifications.

ｷResponsible for both product engineering and new product development.

ｷDrive and develop increased team engagement over time.

ｷUnderstand organizational need to remove under performers and develop the next generation of leaders.

ｷTalent Exportation.

ｷResponsible for establishing the budget and strategic directions achieving goals.

ｷExpected to handle complex or difficult situations as appropriate.

ｷSigns as the final release authority on engineering drawings and other documentation.





QUALIFICATIONS:

ｷUndergraduate degree in Engineering or with equivalent schooling in statistics, mech. of materials, fatigue and stress analysis, and calculus. MS/MBA desired.

ｷ At least five (5) years experience working as an engineer on successful product development efforts.  At least two (2) years of management responsibility.  Specific experience in Marketing, or Quality, and/ or Operations is preferred.

ｷMust be PC literate.

ｷBasic skills - Time management, project management, reports and budget, stress management, conflict management, re-engineering, customer service, ISO, Windows, advanced computer, ERP, statistics, manufacturing process, metrology, auditing, mechanical support, blue print reading, financial systems

ｷFunctional skills - Product knowledge, material flow and paperwork.

ｷFDA and ISO design and process control systems

ｷFinancial systems, HR system, manufacturing systems, organizational structure and design engineering interface.

ｷAbility to make decisions impacting team members regarding training, coaching/counseling and appropriate follow-up.

ｷAbility to make decisions in regards to compliance issues, product reliability and analysis of testing methodologies.

ｷAbility to make decisions impacting team members regarding training, coaching/counseling and appropriate follow-up.

ｷAbility to make decisions in regards to compliance issues, product reliability and analysis of testing methodologies.

ｷJob demands include prolonged sitting, may need to stoop, bend and stand as appropriate.

ｷRequires coordination of hands and/or eye/hand/foot.

ｷMeets cognitive demands to include visual discrimination/memory, auditory discrimination/memory reading ability, independent decision making and retention of specific knowledge.

ｷRequires use of safety glasses in designated areas.]]> </description>
    </item>


    <item>
     <title>chemist in uae ,soudi,oman in gulf region
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22465/Forms</link>
      <description><![CDATA[fresher]]> </description>
    </item>


    <item>
     <title>Head-Quality in Hosur / Near Bangalore
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22496/Forms</link>
      <description><![CDATA[ｷ	To head Quality Assurance and Quality control departments.
ｷ	Overall responsibilities of Quality Control, Shift management & work allocation, Instruments availability, stability studies, calibration, Laboratory Control.
ｷ	Support to SHE in effluent characterization.
ｷ	Monitoring the cost incurred by QA, CAPEX Planning.
ｷ	Support for Analytical method development for new products and new raw materials.
ｷ	Support for new supplier development for existing raw materials.
ｷ	Monitoring / Implementation of cGMP practices in the plant, validations, handling of customer complaints, customer visits, audits
ｷ	To provide necessary analytical support for filing dossiers for new products.
ｷ	Validation of analytical methods, documentation as per ISO requirements etc.

Key Responsibilities :

ｷ	To guide analytical team in new method development for raw materials and finished products.
ｷ	To provide timely support to marketing in addressing customer complaints.
ｷ	To ensure improvements in the implemented quality systems.
ｷ	Overall responsibility of QA and QC.]]> </description>
    </item>


    <item>
     <title>Head-Quality in Hosur / Near Bangalore
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22498/Forms</link>
      <description><![CDATA[ｷ	To head Quality Assurance and Quality control departments.
ｷ	Overall responsibilities of Quality Control, Shift management & work allocation, Instruments availability, stability studies, calibration, Laboratory Control.
ｷ	Support to SHE in effluent characterization.
ｷ	Monitoring the cost incurred by QA, CAPEX Planning.
ｷ	Support for Analytical method development for new products and new raw materials.
ｷ	Support for new supplier development for existing raw materials.
ｷ	Monitoring / Implementation of cGMP practices in the plant, validations, handling of customer complaints, customer visits, audits
ｷ	To provide necessary analytical support for filing dossiers for new products.
ｷ	Validation of analytical methods, documentation as per ISO requirements etc.

Key Responsibilities :

ｷ	To guide analytical team in new method development for raw materials and finished products.
ｷ	To provide timely support to marketing in addressing customer complaints.
ｷ	To ensure improvements in the implemented quality systems.
ｷ	Overall responsibility of QA and QC.]]> </description>
    </item>


    <item>
     <title>Sr. Research Officer in Near bangalore / Hosur
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22499/Forms</link>
      <description><![CDATA[Job Description

Analysis of R&D samples and new method development.
Conducting stability studies as per schedule;
Calibration of Analytical Instruments, Handling the shift independently, Development of working reference standards for finished products, Validation of new Analytical methods, Documentation as per ISO requirements, etc.

Responsibility:

To carry out testing and inspection for all new raw materials, in-process reaction monitoring samples and finished products.
Inspection and testing would encompass both wet analysis and instrumental methods of analysis.
To maintain all testing records in line with ISO-9001 and cGMP requirements.]]> </description>
    </item>


    <item>
     <title>Sr. Analyst/Group Leader in Mumbai,Andheri (E)
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/22592/Forms</link>
      <description><![CDATA[1) Develop & validate analytical method as per Standard Operating Procedure(SOP).
2) Accompany service engineer in case of maintenance.
3) Operate, maintain & calibrate various lab. equipments.
4) Prepare project specific lab. documents for assigned projects.
5) Prepare report for method validation & analytical part of biostudy.
6) Prepare & update analytical & general SOPs.]]> </description>
    </item>


    <item>
     <title>SENIOR SCIENTIST in USA AND INDIA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8221/Forms</link>
      <description><![CDATA[This is an amazing salary for India.They want a US experienced person for their team in India.EXPERIENCE IN MULTI STEP SYNTHESIS AND NOTABLE TRACK RECORD OF SCIENTIFIC ACHIEVEMENTSAT LEAST 1-3 DRUG DISCOVERY RESEARCH EXPERIENCE IN AN INDUSTRIAL PHARMACEUTICAL SETTING.Development of Non-Infringing routes for APIs / intermediates.developing Dossiers for registration in developed Countries of Europe, Australia, New Zealand, Brazil and gearing up for filing of ANDAﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ｢ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ､ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?ﾃ?ﾂ?s in USA.]]> </description>
    </item>


    <item>
     <title>bioinformatician(Drug discovery) in hyderabad,India
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8222/Forms</link>
      <description><![CDATA[Structure based drug design
Rational drug design
protein modeling]]> </description>
    </item>


    <item>
     <title>VP (R&D) in Mumbai
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8224/Forms</link>
      <description><![CDATA[1. To Plan and develop efficient process for manufacture of exiting Molecules and guide, supervise all the R & D activities.

ｾ	To develop process for New Molecules and Scale up implementation from laboratory level to commercial production level.

ｾ	To stabilize processes to optimize and standardize reaction conditions.

ｾ	To prepare process transfer technology docket.

ｾ	To identify problems ? deviations in reaction conditions and trouble-shoot and improve the process of the exiting commercialized products.

ｾ	To actively contribute in the process of selection of New molecules for development and its economic feasibility and assessment of suitability and capability of the existing plant and processes.

ｾ	To participate and contribute to activities related to patents which include necessary date filling, drafting and developing non-infringing processes.

ｾ	To contribute effectively to improve Customer satisfaction, their specific requirements more particularly related to impurities levels, preparation of samples.

ｾ	To assist in the preparation of raw material and intermediates specifications.

ｾ	To be involved with all activities related to Custom Synthesis more specially co-ordinate of]]> </description>
    </item>


    <item>
     <title>Medicinal Chemistry Research Associate in San Diego
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8262/Forms</link>
      <description><![CDATA[BSc MSc level Medicinal Chemist.

Small molecule drug discovery @ GPCRs]]> </description>
    </item>


    <item>
     <title>Sr. Research Scientist DMPK in Bay Area
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8643/Forms</link>
      <description><![CDATA[My client is in search of a laboratory-based leader of a bioanalytics team responsible for drug metabolism and pharmacokinetics studies in a dynamic small molecule-based drug discovery program providing support for multiple discovery projects. Responsibilities include study, design, and analysis and result interpretation for lead validation/optimization in ADME/PK, pharmacodynamics and toxicokinetics studies. Laboratory equipped with 7 contemporary LC/MS/MS systems. This position requires a Ph.D. in Pharmacology, Pharmaceutical Chemistry, Bioanalytical Chemistry or related discipline with 5+ years industry experience in PK and Bioanalytical Chemistry. Strong knowledge and educational background in ADME/PK and extensive hands-on experience with bioanalytical instrumentation (LC/MS/MS, HPLC, and NMR), method development, data analysis and interpretation. The successful candidate will possess strong oral and written communication skills. Experience in lab automation is preferred.]]> </description>
    </item>


    <item>
     <title>ANALYTICAL CHEMIST in ANY SUITABLE
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8647/Forms</link>
      <description><![CDATA[Job profile	 :

a)Assisting for Method validation for
GC, HPLC methods as per Protocols.

b)Qualification of Analytical
Instruments-GC, HPLC,X-RD, Malvern
Particle Size Analyzer.

c)Instrument handled-
GC: Shimadzu, PerkinElmer,
Clarus,Chemito&Nucon,HPLC:Waters,
Shimadzu 2010   series. PSD: Malvern Particle size analyzer,
X-RD-Shimadzu 7000S.
Auto Titrator-Metrohm

d)Software played:-
Empower,Class Vp,Lab solution/GC
solution.Total Chrom,TurboChrom,Class
LC10/GC10,Master Sizer 2000,Shimadzu
7000s.

e)Protocol preparation and performance
of Method transfer,Method
verification for HPLC,GC,UV,&X-RD
methods as per Protocols.

f)Trouble Shooting and critical spares maintenance for X-RD,GC, Malvern PSD.

g)Pharmacopeias Reference Standard as per USP,BP/EP analysis and maintenance as SOP.

h)IRS/WRS preparation, analysis and maintenance.GC reference solvents & Column performance and documentation as per procedure.

i)Computer System validation with Analytical instruments-GC,HPLC,UV,FT-IR,X-RD and particle size Analyser as per CFR 21 Part 11 Procedure.

j)OJT for new comers and its documentation as per procedure.

k)OOS for Raw materials and its documentations as per procedure.

l)AMC for critical Analytical instruments as per STP.

m)Preventive maintenance for critical instruments GC,HPLC and PSD-Analyzer.

n)Backup, Restoration, Password Maintenance of an analytical systems & Computers.

o)Spread Sheet Validation(Excel) for standard deviation & Relative standard deviation.]]> </description>
    </item>


    <item>
     <title>Research Chemist in Any suitable
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8649/Forms</link>
      <description><![CDATA[Present Experience:-
Company Name : Shasun Chemicals & Drugs Ltd.,
Date start	 : June?1997
Date end	 : Till Date
Job Title	 : Officer_ Quality Control

Job profile	 :
a)Assisting for Method validation for GC, HPLC methods as per Protocols.

b)Qualification of Analytical Instruments-GC, HPLC,X-RD, Malvern Particle Size Analyzer.

c)Instrument handled-
GC: Shimadzu, PerkinElmer, Clarus,Chemito&Nucon,HPLC:Waters,
Shimadzu 2010   series. PSD: Malvern Particle size analyzer, X-RD-Shimadzu 7000S.
Auto Titrator-Metrohm
d)Software played:-
Empower,Class Vp,Lab solution/GC solution.
Total Chrom,TurboChrom,Class LC10/GC10,Master Sizer 2000,Shimadzu 7000s.

e)Protocol preparation and performance of Method transfer,Method verification
for HPLC,GC,UV,&X-RD methods as per Protocols.

f)Trouble Shooting and critical spares maintenance for X-RD,GC, Malvern PSD.

g)Pharmacopeias Reference Standard as per USP,BP/EP analysis and maintenance as SOP.

h)IRS/WRS preparation, analysis and maintenance.GC reference solvents & Column
performance and documentation as per procedure.

i)Computer System validation with Analytical instruments-GC,HPLC,UV,FT-IR,X-RD and
particle size Analyser as per CFR 21 Part 11 Procedure.

j)OJT for new comers and its documentation as per procedure.

k)OOS for Raw materials and its documentations as per procedure.

l)AMC for critical Analytical instruments as per STP.

m)Preventive maintenance for critical instruments GC,HPLC and PSD-Analyzer.

n)Backup, Restoration, Password Maintenance of an analytical systems & Computers.

o)Spread Sheet Validation(Excel) for standard deviation & Relative standard deviation.]]> </description>
    </item>


    <item>
     <title>R&D Manager in Bangalore, India
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/8044/Forms</link>
      <description><![CDATA[Design and execution of experiments for custom synthesis of building blocks of amino acid chemistry and chiral intermediates. Also shall be heading a 10 member team. Selected individual will have more than 5 years experience in our technology and industry.]]> </description>
    </item>


    <item>
     <title>Research Associates-Organic Chemistry in Montpellier-France
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/7980/Forms</link>
      <description><![CDATA[Seeking 3 Research Associates-Organic Chemistry
Synthesis, characterization and study of nitrogen heterocycles or other small molecules of interest for antiviral activity. The Laboratory is located in Montpellier, south of France where there is already a group of 30 scientists and technicians exclusively dedicated to drug discovery chemistry.]]> </description>
    </item>


    <item>
     <title>Clinical Marketing and Sales in Hydrabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/7750/Forms</link>
      <description><![CDATA[Pharmaceutical Industry seeks a top notch Marketing Professional for the above mentioned slot.  They are a Research and testing Services Company with world - class quality standards. Their vision is to be among top 10 contract research and testing organizations globally by 2010

Job Description
*Candidate will be responsible for the overall Marketing of Clinical Reference Lab Services of the company. *As Profit Centre Head, the responsibilities include Sales plan, Territory mapping, Decision making, Achieving the Targets for Revenue and collection, Sales force training and management, Patient Service Center management, etc.,

Desired Profile
*The candidate should have around 10 - 15 years of track record in a Senior Management position. *The candidate should have extensive sales knowledge and work experience relating to marketing of Lab services on Pathology, on all India basis. *The candidate needs to travel at least 20 days in a month. *The Candidate should be extremely strong in communication, interpersonal and leadership skills. *The candidate should also have experience in people management as well as the management of performance from fellow colleagues.

*Qualifications: Post Graduate in Bio-Sciences/ M.B.B.S/ M.D. or Ph D., in Pathology. A post graduate degree in Management will be preferred.

Age range: 35 - 40 years
Minimum Experience: 12 years
Maximum Experience: 16 years
Remuneration: Best in Industry, inclusive of performance incentive.
Location: Andhra Pradesh - Hyderabad / Secunderabad, (However, transferable to any place in India.)]]> </description>
    </item>


    <item>
     <title>reserch scientist in any
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/7580/Forms</link>
      <description><![CDATA[method development and validation as per ich]]> </description>
    </item>


    <item>
     <title>Chemistry & Materials Section Supervisor in Las Cruces, New Mexico
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/6875/Forms</link>
      <description><![CDATA[Responsible for technical and administrative supervision of 30 personnel in the Chemistry & Materials Section of the Laboratories Department.
Ensure planning for and execution of Chemistry & Materials Section mission. Requires budget planning and maintenance, direction and approval of technical activities, along with personnel selection and management. Responsible for ensuring the effective use of project management tools for the CMS section budget and projects. Will work closely with counterparts to maintain quality of product and timeliness of delivery. Provides open communication with CMS section personnel and coaching and mentoring as required. Ensures CMS operations mesh with overall Laboratories Department objectives. Functions as Certifying Official for Training Classifications owned by the CMS section.
As an Equal Opportunity Employer, we are committed to a diverse workforce
Qualified applicants will have a Bachelor's Degree (or higher) in Chemistry and/or Materials Science and at least five years of directly applicable experience, including direct supervision in a laboratory setting. Excellent communication and interpersonal skills are required. Must be able to pass a physical examination consistent with the requirements of the position as determined by the company.]]> </description>
    </item>


    <item>
     <title>Director of Risk management in Irvine, CA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/6774/Forms</link>
      <description><![CDATA[Our client is a global, publicly traded, research-based company that discovers, develops, manufactures and markets a broad range of Pharmaceutical products.

Job Description:
*	Direct all risk management functions globally
*	Responsible for all major insurance policies including property, business interruption, liability, product liability, clinical trial, D&O, automotive and workers compensation.
*	Research, develop and implement renewal strategies including cost saving and risk mitigation initiatives.
*	Research, collect, analyze, organize, and submit underwriting data.
*	Manage insurance brokers and make proper recommendations to executive management.
*	Manage ex-US insurance programs which comply with local laws and regulations while meeting overall corporate needs.
*	Create and maintain a standardized insurance reporting, compliance and risk management program.

Education/Skills Required:
*	BA/BS degree Business and/or Sciences
*	MBA or advanced Degree / Certifications highly preferred

Qualifications Required:
*	10 years experience in risk management or with insurance company or broker,
*	Preferably with knowledge and experience in the pharmaceutical/biotechnology industry including product liability and clinical trial insurance exposure
*	Experience with property/casualty as well as D&O insurance.
*	Expert level research skills required to develop international risk strategies.
*	Identifies alternative approaches to risk management problems.
*	Collaborates well within and outside department function.
*	Good written and verbal communication skills.]]> </description>
    </item>


    <item>
     <title>Sr. Scientist, Drug Formulation in Seattle, Washington
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/6549/Forms</link>
      <description><![CDATA[Title: Manager, Aerosol Formulation - 200444

Description:
The successful candidate will play a key role in the implementation of a comprehensive drug delivery strategy for Corus products. Reporting to the Director of Inhalation Technology, this person will be responsible for optimizing the drug delivery performance of Corus' respiratory products. This work will focus on the interaction between drug formulations and devices, and involve collaboration with Corus Research and Manufacturing groups as well as external formulation development and testing contractors.

Essential Functions of the Position:
Lead the development effort to optimize formulations for the chosen delivery system for Corus respiratory products.
Support Research department with formulation characterization (physical properties, stability, etc,) of feasibility programs.
Manage internal teams and external formulation development organizations.
Contribute to clinical and regulatory documentation.
Some travel required.
Qualifications:
Minumum B.S. in Chemical Engineering, Chemistry, or equivalent.
At least 8 years industrial experience in formulation development.
Experience with liquid inhalation formulations a must, dry powder formulations desired.
Excellent analysis and communication skills.
Ability to work well in a team environment.]]> </description>
    </item>


    <item>
     <title>SCIENTIFIC MARKETING DIRECTOR in US/Canada
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/6363/Forms</link>
      <description><![CDATA[We are looking for a top-quality Scientific Marketing professional who would play a leading role in promoting our products and expanding our business directions. The required qualifications include Ph D in chemistry or closely related area, several years of work experience in a key drug discovery position in pharma industry, in-depth knowledge of physical organic chemistry, QSAR/cheminformatics and pharmacokinetics. Excellent leadership and public speaking skills, good scientific writing and organizational skills, the ability to quickly absorb new technical/scientific information and get things done in time are of essential importance. Responsibilities will include scientific representation of our company to the users, relating our products to practical problem solving in many different R & D areas, designing product marketing strategies, and developing strategic relationships. In particular, this involves identifying specific market niches, formulating practical product applications, identifying selling points, creating application notes and real-life case studies, designing web announcements and e-newsletters, planning marketing events, public speaking during scientific conferences and customer's site visits, and solving many related problems. A successful candidate should be able to demonstrate a good knowledge of our products and their practical application areas, describe possible business expansion directions, and propose a plan of practical steps. Relocation not required (work from home while being in close contact with Sales and Development), but you must reside in US or Canada, and be willing to travel on a frequent basis. Residence in CT, MA, NC, NJ, PA or other states rich of pharma R & D centers is preferable.]]> </description>
    </item>


    <item>
     <title>Research Potision in Computational Physics/Chemistry in Moscow, Russia
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/6350/Forms</link>
      <description><![CDATA[An American bio-pharmaceutical company seeks out a qualified scientist for a Researcher position to work in the company's Research Branch in Moscow. The duties will involve development and numerical implementation of the state-of-the-art quantum-mechanical methods for very precise calculations of the properties of biologically related molecules and their interaction.Skills: (a) excellence in quantum mechanics; (b) good theoretical background and practice in numerical methods; (c) fluency in programming (Fortran); (d) ability to work in a group; (e) experience in quantum calculations of atomic and molecular properties and/or in distributed computation would be an advantage.Salary: starting from 600-1200$ per month, depending on qualification.Deadline: October 31, 2004 or until the position filled.Contacts: Applicants should send an application letter with a full CV, including names of two referees, a list of publications, description of research and experience, to cv@algodign.com]]> </description>
    </item>


    <item>
     <title>Chief - Clinical Trials in Delhi
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/5828/Forms</link>
      <description><![CDATA[Capable of understanding, developing, leading all aspects of clinical trials and contract research business

Ample experience of clinical trials - a minimum of 15 years professional experience and at least 5 years in a Clinical Trials / Contract Research organization]]> </description>
    </item>


    <item>
     <title>Life Sciences Research Scientist in Troy, NY
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/5608/Forms</link>
      <description><![CDATA[The main functions of the position are in R&D (70%), sales, marketing and business development support (25%) and manufacturing support (5%).The candidate will be the principle investigator for the research and development of nanocrystals (quantum dots) and nanocrystal conjugates for biological applications. The candidate will lead new product development and coordinate with the CTO/sales/marketing to develop strategic technology plans for biotechnology applications. The candidate will be the lead contact for external collaborators working on biological applications and support partners' research and development efforts to ensure their success.
Deep knowledge of conjugation chemistries and the ability to demonstrate viability of reagents/product for specific applications is necessary. Candidate will have the ability to create novel biological reagents and new conjugation schemes and develop new bioassays. Excellent problem solving skills, presentation skills and ability to interact with customers and business partners required. The ideal candidate will have a degree in biochemisty, molecular biology, cell biology, immunohistochemistry or other related degree. PhD is preferred but not required. Some travel to customer site and trade shows is required.]]> </description>
    </item>


    <item>
     <title>Research and Development Manager in Toronto Ontario Canada
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/5600/Forms</link>
      <description><![CDATA[ﾃδづつｷ	Contribute to the evaluation and development of new inquiries (i.e. cost and resource allocation)  ﾃδづつｷ	Develops process research project plans in collaboration that incorporate small-scale manufacture with other staff (e.g. Business Development, Pilot Plant) ﾃδづつｷ	Collaborate with other R+D Managers in assigning resources (lab space, equipment and staff) to projectsﾃδづつｷ	Co-ordinate multi-functional project teams  ﾃδづつｷ	Monitor project plans progress through tools such as regular status meetings, schedule reviews, Gantt Charts and facilitate resolution of outstanding issuesﾃδづつｷ	Lead in the management of staff through contributing to activities such as recruitment and performance management ﾃδづつｷ	Provide advice to staff in R+D project leadership roles ﾃδづつｷ	Fulfil point of contact role for clients on scientific matters related to projectﾃδづつｷ	Prepare final project reportsﾃδづつｷ	Participate in project evaluations through report review, analysis and coaching  ﾃδづつｷ	Ensure safe and clean lab operations ﾃδづつｷ	Proven experience in project management ﾃδづつｷ	Advanced knowledge of synthetic organic and process chemistryﾃδづつｷ	Strong knowledge and experience with production capabilities in pilot plant and kilo lab environments under cGMPﾃδづつｷ	Understanding of analytical chemistry and regulatory affairs would be an asset ﾃδづつｷ	Knowledge and experience in operational leadership including resource management skills]]> </description>
    </item>


    <item>
     <title>Program Director in Rockville, Maryland
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/5485/Forms</link>
      <description><![CDATA[We are recruiting for a Program Director , the goal of which is to increase academic access to molecular probes identified by high throughput molecular screening (HTS) and to broaden the application of HTS in the study of biology and disease.  This individual will be a key contributor to NINDS activities related to the Molecular Libraries Roadmap, including assay development, high throughput screening, establishment of compound libraries, and technology development. These activities will include leadership in programs to encourage the use of HTS through 1) the development of a broad range of novel biological assays for HTS and 2) the generation of a bioactive compound collection for distribution to the research community.   Although experience with assays for compound screening is expected, relevant experience may include research in cell biology, molecular biology, or pharmacology in academic or for-profit institutions.  The successful candidate will join a highly interactive group of scientists directing research programs in a wide range of areas of biomedical science at the NIH.  He/she will maintain active communication with the extramural professional community as well as with program staff in other government institutes and agencies.]]> </description>
    </item>


    <item>
     <title>bioinfomatician in Hyderabad
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/5360/Forms</link>
      <description><![CDATA[Drug designing / protein modelling]]> </description>
    </item>


    <item>
     <title>Business Analyst - Life Science / Biotechnology in Bangalore, India
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/5348/Forms</link>
      <description><![CDATA[Person should be from the field of Life sciences or Bio Technology domain.
Major responsibility of Business Analyst is to analyze requirements and develop functional design of a product. Functional design includes work flow and user interface design, as well as the business rules definition. In addition Business Analyst will be main contact person for information related to functional requirement of the system. And business analyst assists software developers, Technical Writer and Quality Control Engineers in understanding the system requirement of the products.]]> </description>
    </item>


    <item>
     <title>Synthetic Process Chemist - Seeking Master Chemists for a leading company! in Southern CA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/3622/Forms</link>
      <description><![CDATA[Great Opportunities for Master Chemists!

Confidential Company is seeking a team of Synthetic Process Engineers to join their growing company.  Company is a leading supplier of ketone proxides, metallic stearate and provides state-of-the-art customized synthesis and separation services to clients in the areas of medicinal chemistry,chemical development,cGMP synthesis,and advanced separation technology.

Location:  So. California.  Must be willing to relocate.  Local Candidates are preferred, however, relocation assistance will be provided for selected candidates.

Compensation:  Competitive

Experience Required:
M.S. Chemistry (major academic institution preferred)
Academic projects should reflect a solid background in organic synthesis. The candidate will have several peer-reviewed publications describing doctoral and postdoctoral work
Experience in natural product synthesis and heterocyclic chemistry is preferred but not required
4-6 years of solid industrial process bench experience, including small scale academic work to multi-Kg preps and cGMP
Previous experience working adhesives or polymer chemistry
Experience with statistical and process control techniques
Experience working in an ISO 9001 environment

Teamwork, independent problem solving skills, interpersonal skills, ability to work effectively in a multidisciplinary discovery team environment, and excellent verbal and written communication skills]]> </description>
    </item>


    <item>
     <title>Lab Analyst/Technician in Hayward,CA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/3600/Forms</link>
      <description><![CDATA[Qualified candidates will be involved in
the synthesis of novel organic compounds
and the development of new synthetic
technologies for drug discovery.
Candidates should have BS/MS in organic
chemistry with relevant research
experience, and technical proficiency
with synthetic organic chemistry,
including multi-step organic synthesis,
purification and characterization.]]> </description>
    </item>


    <item>
     <title>Computational Chemist in Palo Alto
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/3595/Forms</link>
      <description><![CDATA[Chemistry PhD with 3-5 years of experience in computational
chemistry/molecular modeling, QSAR/QSPR methods, competence in
computer-aided molecular design and molecular mechanics/dynamics.
Competence in modern techniques of computer-aided chemistry,
biochemistry, bioinformartics algorithms, cheminformatics alogorithms
that help discover and optimize potential lead compounds for drug
discovery.  Strong statistics background is also desirable.

We are an exciting early-stage startup located in the Bay Area
offering attractive equity for part or full-time employees.]]> </description>
    </item>


    <item>
     <title>Multiple Pharma Openings, Interview in Progress. Pl. Apply Immediately. in Mumbai, India
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/3458/Forms</link>
      <description><![CDATA[1) Vice President/ Manager :  International Marketing/  Sales
Location : Andheri (Mumbai)
No. of Opening : 1 No.
Qualification : Graduate in  Chemistry with MBA in Marketing
Experience : 5 to 8 years of  experience  in Bulk Drug  International  Marketing
The candidate will    be responsible for formulating and implementing sales
strategies and defining business plans .
__________________________________________________________________________
2) Manager QA/QC
Location : Tarapur  (Near Mumbai)
No. of Opening : 1 No.
Qualification :  M.Sc. / Ph.D ( Organic /Analytical chemistry .)
Experience : 10 to 12 years experience  in Bulk Drug industry
__________________________________________________________________________
3) Product Manager
Location : Kandivali , Mumbai
No. of Opening : 1 No
Qualification :  B.Pharm ,  MBA
Experience : 2 to 4 years working as Product  Manager / Executive
___________________________________________________________________________
4) Product Executive /Officer
Location : Kandivali , Mumbai
No. of Opening : 1 No
Qualification :  B. Pharm, MBA
Experience : 2 to 4 years working as Product Executive /  Officer.
__________________________________________________________________________
5 )  Assistant Manager (Production)
Location : Dombivli  (Near Mumbai)
No. of Opening : 1 No.
Qualification :  B.E.( Chemical) / M.Sc. (Chemistry )
Experience :  10 years of experience in   Production  in bulk drug industry .
__________________________________________________________________________
6 ) Asst. Manager ( R. & D.)
Location : Dombivli  (Near Mumbai)
No. of Opening : 1 No.
Qualification :  M. Sc.
Experience :  8 + years of experience in R.& D. Department of Pharma. Industry.
__________________________________________________________________________
7) International   Marketing Executives
Location : Andheri (Mumbai)
No. of Opening : 2  Nos.
The candidate will be responsible for International Marketing / Sales
Qualification : Graduate in  Chemistry with MBA in Marketing
Experience : Experience : 0 to 3 years
Bulk drug  International  Marketing will be preferred.
__________________________________________________________________________
8)  Regulatory Officer
Location : Andheri (Mumbai)
No. of Openings : 2  Nos.
The candidate will be   supporting sales team
Qualification :  B.Pharm with MBA
Experience :Experience : 0 to 3 years
Prior Experience in  International Bulk Drug  Regulation  will be preferred.
___________________________________________________________________________
9)  Materials Executive
Location : Andheri (Mumbai)
No. of Opening : 2  Nos.
Qualification :  B.E ( Chemical)/ Graduate in Chemistry  with P.G. in Material Management
Experience :  2 to 3 years.
______________________________________________________________________________
10)   Import / Export Executives  ( Logistics )
Location : Andheri (Mumbai)
Import : No. of Opening : 1 No. &   Export : No. of Opening : 1 No.
Qualification :  Commerce Graduate , Computer Literate,
Experience :  2 to 5  years experience  in Logistics matters , Pre and post Shipment , L/C analysis,
Export documentation , DGFT & Advance Licence and co-ordination with  Manufacturing units
_______________________________________________________________________________
11) Export Executive/Assistant
Location : Kandivali  ( Mumbai )
No. of Opening : 1 No
Qualification :  Graduate
Experience : 2  to 5 years   in  Export  Documentation , DGFT and Advance Licence ,
Pre and post Shipment , DGFT & Advance Licence and co-ordination with  Manufacturing units
_______________________________________________________________________________________
12)  Information Scientist
Location : Andheri (Mumbai)
No. of Opening : 2  Nos.
Qualification : M.Sc , Ph.D. (Chemistry)
Experience :  Minimum 2 +  years in Pharma Industry.
______________________________________________________________________________
13 ) MD (Tech Team)
Location : Andheri (Mumbai)
No. of Opening : 1  No.
Qualification : M.Tech. / M.E. (Chemical)
Experience :  Experience : 0 to 3 years
Bulk Drug Experience    will be preferred.
____________________________________________________________________________
14 )  Sr. Executive- QA/QC
Location : Tarapur  (Near Mumbai)
No. of Openings : 2  No.
Qualification :  M Sc
Experience :  5 to 8 years  Bulk Drug  QA/QC Experience
______________________________________________________________________________
15) Sr. Executive QC
Location : Tarapur / Dombivali  (Near Mumbai)
No. of Openings : 2  No.
Qualification :  M.Sc
Experience :   4 to 5 years of experience  and knowledge of
sophisticated instruments
____________________________________________________________________________
16) Sr. Executive AMD
Location :  Dombivali  (Near Mumbai)
No. of Opening : 1  No.
Qualification :  M.Sc /  B.Sc with Chemistry
Experience :  5 to 8 years
Location : Dombivali  (Near Mumbai)
____________________________________________________________________________
17) Associate AMD
Location :  Dombivali  (Near Mumbai)
No. of Openings : 3  No.
Qualification : M.Sc or B.Sc with chemistry
Experience : 2 to 5 years
_____________________________________________________________________________
19)) R & D Executive (Projects)
Location :  Dombivali  (Near Mumbai)
No. of Openings : 4  No.
Qualification :   M.Tech /  B .Tech ( Chemical)
Experience :  0 to 3 years
Transferring R.& D. into production of Bulk Drugs.
______________________________________________________________________________
19) R & D Associates
Location :  Dombivali  (Near Mumbai)
No. of Openings : 3  No.
Qualification :  M Sc. (Chemistry)
Experience :   1 to 2 years experience of transferring R.& D. into production  of Bulk Drugs.
_______________________________________________________________________________
20 )  Executive QC
Location :  Dombivali  (Near Mumbai)
No. of Opening : 1  No.
Qualifation :  M.Sc (Chemistry )
Experience :   4 to 6 years of experience in Bulk  Drug QC
_______________________________________________________________________________
21) Manager - FINANCE
Location :  Andheri , Mumbai
No. of Opening : 1 No.
Qualification : CA / Cost accountant +  MBA Finance
He will be responsible for Financial Planning
management accounting and Budgetary Control, Treasury
and MIS  and provide inputs on all strategic matters encompassing
operations, productivity etc.
Exposure to arrangement of term loan/equity fund from financial
institutions, costing & budgeting, inventory control, working capital
management etc. is essential.
Age Group :  35 - 40
Experience : 6 to 10 years  in a large organization., Pharma Industry background
will be preferred.
_______________________________________________________________________
22) Officer Finance
Location : Tarapur  (Near Mumbai)
No. of Opening : 1 No.
Qualification :   CA / ICWA
Experience : 2  to 3 years experience
Knowledge of excise is a must
________________________________________________________________________________
23)  Systems Executive
Location : Andheri (Mumbai)
No. of Opening : 1  No.
Qualification : Graduate with Diploma in hardware /Software
Experience : 2 to 4  years
______________________________________________________________________________
24) Quality Control Officer / Chemist
Location : Kandivali (Mumbai)
No. Of openings : 2 No.
Qualification : M.Sc./ B.Sc.
Experience : He Should be 2-4 years exp. in similar field and having knowledge of :
1. Analysis of finished products (Tablets, caps, Injections)
2. Sophisticated instrument handling
a) HPCL b) F.T.I.R.  c) UV spectrophotometer
3. Calibration of all Q.C Instruments
4.Packing Materials : Foil, Carton


_____________________________________________________________________________________________
27)  Trainee Stores Officer
Location : Tarapur  (Near Mumbai)
No. of Opening : 1 No.
Qualification :  B.Sc. (Chemistry)
Experience : 2 to 3 years experience  in Pharma industry
_______]]> </description>
    </item>


    <item>
     <title>Project Manager in New Jersey-USA
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/3412/Forms</link>
      <description><![CDATA[?]]> </description>
    </item>


    <item>
     <title>Scientist in Philadlephia area
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/3327/Forms</link>
      <description><![CDATA[?]]> </description>
    </item>


    <item>
     <title>Senior Drug Discovery Applications Scientist in New York
</title>
     <link>http://chemistry.freerecruiting.com/Resumes/Members/3289/Forms</link>
      <description><![CDATA[Senior Drug Discovery Applications
Scientist

I am assisting to recruit
a Senior Drug Discovery
Applications Scientist for a client
with in New York.

This client is recognized as a
high-growth leader in the
development and delivery
computational methods for drug
discovery and development.   This
company
offers excellent compensation
and generous benefits.
Here is more information:

They are seeking a scientist
for their Drug Discovery Applications
Group. The successful candidate
will become part of a multidisciplinary
drug discovery team working on
both in-house efforts to improve and
apply drug discovery methodologies and
on collaborative projects with
pharmaceutical/biotechnology partners.

Job Description:
Actively participate in Drug Discovery
Applications Group projects
Apply drug discovery software and
perform analysis of the results
Effectively communicate results to
other members of the Group
Work closely with the Development
Team to test and improve Drug
Discovery technologies

Essential Qualifications and Experience:
Ph.D. in computational chemistry,
organic chemistry,
or biochemistry Computational
experience in at least
1 of the following areas:
molecular modeling, structure-based
drug design, virtual ligand screening,
computationally-driven lead
optimization,
ligand-based design,
or homology modeling
Excellent verbal and written
communication skills
Ability to work independently

Desirable Skills:  Programming skills:
Perl script
writing, in particular.  Experience
with chemical databases

Benefits include: Medical, Dental,
401K,
Flexible Spending Account,
3+ weeks vacation
and tuition reimbursement.

-your resume in word or text format
-your salary requirement

It is important to use the position
title as the subject of your
email to enable your
resume to reach
me as quickly as possible.

If you aren't interested or
feel you are not qualified,
do you know anyone
who would be interested?
We do offer generous referral fees.
Thanks for your time and have a
great day!]]> </description>
    </item>


    <item>
     <title>Sr. Director in San Die