Medicinal and Computational Chemistry Job Market

Researcher

Develpment of new drugs by Traditional Synthesis methods .Full Analysis of new products.Pharmacokinitic Study.Formulation for lnjections.

manager

Please enter your email address below to reset your password. ... Jez Morrow, - Name of a Wolf 33 reads ... Petroceltic has licences in Algeria, Italy and Tunisia. ..... Petroceltic is seeking to convert the large resource estimate into .... The Elsa oil field was discovered in 1992 by ENI and is situated

Bio Chemist Consultant

Looking for a Bio Chemist with experience in making topical creams and lotions and a strong interest in natural / plant-derived ingredients, ayurveda, and aromatherapy.

Mgr. Product Development

We need a very strong background (10+ years) in pharmaceutical management with major pharmaceutical manufacturing facility. Phd would be ideal, but MS would be acceptable. Parenteral experience would be most preferred. This position provides excellent benefits and reports to the VP and has advancement potential. Response will be very quick for the right candidate. This positon is offered as a "Talent Agent Module".

Research Informatics Server & Desktop Support

Description of Position: This position is part of the Research Informatics Application Support Team and combines the support for the software applications associated with the company?s small molecule platform with additional application and infrastructure tasks as assigned. The position will encompass the following responsibilities: ? Analyzing and troubleshooting problems encountered by Medicinal Chemists or Computational Biologists related to vendor and custom software applications ? Managing license and maintenance contracts for assigned applications ? Performing application installations and upgrades ? Testing applications prior to equipment and version upgrades ? Providing backup support for additional software applications as assigned ? Performing general Windows administration and troubleshooting support tasks for applications, workstations and servers as assigned. ? Following required procedures to coordinate with IT on all installations, upgrades and purchases ? Participating in the creation of system and support documentation for custom applications ? Maintaining all required documentation and records Familiarity with the following, or similar, software applications is required. ? CambrideSoft ChemOffice Suite, Various MDL Databases, ChemSW CisPro, Accelrys Accord Enterprise and Excel for Accord, Chemistry eNotebooks, Windows XP and Windows 2003/2008 Server administrative processes. Technical Requirements ? Working knowledge of Windows XP and 2003/2008 server (TCP/IP, DNS, WINS) ? Sufficient knowledge of IIS, Apache, Web Services, Active Directory, Group Policies, File/Share Security to effectively troubleshoot application performance issues. Experience ? 3 to 5 years as a systems administrator of applications in a Windows environment ? 3 years supporting scientific applications and users in an environment with a mix of Windows, Linux, and Mac operating systems ? 2 to 3 years experience working in a research environment as a medicinal or process chemist Preferences: ? Excellent communications and customer service skills ? Proven trouble shooting and decision making skills ? Working knowledge of software version control tools ? Preference for working in a collaborative, team environment ? Ability to work independently and with minimal supervision ? Demonstrated ability to establish and meet priorities and deadlines ? Sense of humor Education: ? BS in Chemistry and a BS in Computer Science or equivalent certifications

Requires Import Export Executive (Project Assistant), Sr. Quality Control Engineer in Mumbai

Our client is an Engineering Company engaged in Thermal Process Plant Engineering. We have requirement as follows; 1. Position: Import Export Executive (Project Assistant) Candiate should be well versed with Import/Export documentation and should also be able to act as a support to project team. We are executing projects in Europe/Middle East. Cnadidate with about 1-3 yrs experience can apply. (Male or Female) 2. Position: Sr. Quality Control Engineer Candidate well versed with ispection of Heavy Fabrication Jobs including weld tests, third party inspections etc. 2-4 yrs experience essential.(Male only) Please mail your detail resume with current salary details at : careeyear@yahoo.com Call: +91. 93247. 06012

Clinical Laboratory Scientist

the journey begins with you. There's quite a distance between wondering and knowing. And for patients waiting for answers to important health questions, it's a road they want to travel as quickly as possible. We understand urgency. But more than speed, we focus our energies on accuracy. We currently have openings for Clinical Laboratory Scientist (CLS I & II) in our San Juan Capistrano location. Will set up and report routine assays; Monitor QC and inventory of tests. Responsible for providing routine and special testing by established procedures, evaluating test performance by given criteria and reports clinical results from acceptable test runs. We offer a Competitive Compensation and Benefits Package including: Pay incentives for 2nd and 3rd shifts Paid Time Off Paid Company Holidays 401(k) & fully vested company matching contributions Company funded Employee Stock Ownership Plan (ESOP) Educational Assistance Credit Union Membership Medical/Dental/Life Insurance Goal sharing (bonus program) If you have the dedication and analytical skills to help power our efforts, we invite you to join us on our journey.

Senior Manager, Research and Development

Manage the development, implementation and evaluation of multiple process research projects according to client specifications. Contribute to the evaluation and development of new inquiries (i.e. R+D cost and resource estimates) Develops process research project plans in collaboration with other departments to ensure delivery of overall project objectives Collaborate with R+D Managers in allocating project resources (lab space, equipment and staff) Co-ordinate multi-functional project teams (e.g. analytical, technology transfer, process safety staff) and facilitate the resolution of outstanding issues Monitor project progress through tools such as regular status meetings, schedule reviews, Gantt Charts Lead in the management of staff through activities such as recruitment, performance management and staff development. Act as coach for staff in R+D Manager position. Provide leadership to staff in R+D project leadership roles Fulfil point of contact role for clients on scientific matters related to projects Manage and review final project reports Participate in project evaluations through report review, analysis and coaching Fulfil leadership role in implementation of critical responsibilities (e.g. intellectual property tracking/co-ordination, FED) Monitor compliance with relevant Standard Operating Procedures (SOP?s) and R+D Manuals Ensure safe and clean lab operations

HEAD OF ANALYTICAL CHEMISTRY

APPOINTMENT Our client is currently expanding its chemistry capabilities to augment their strength in Chemistry and the Head of Analytical Chemistry is seen as a key appointment for the next phase in the Company?s evolution. Under the guidance of the Head of Chemistry, the Head of Analytical Chemistry will establish a Department to allow chemists to routinely analyse (in an open-access fashion) their samples. The Head of Analytical Chemistry will also put in place procedures to maintain equipment and minimise down-time, will carry out development and optimisation of purification methods and purify compounds originating from chemistry (both as singletons and library samples) as a service. This may be accomplished using a variety of methodologies gleaned from their experience to date and through importing known industry Best Practice. Additionally, over time, they will help to establish the equipment and internal know-how to analyse (bioanalytically) plasma samples. PROFILE � Degree educated in analytical chemistry (BSc 2i minimum, or equivalent); � Minimum 5 years? relevant post-doctoral or industrial experience and ideally with exposure to working in a matrix-type organisation; � Candidates without a non-analytical qualification (e.g. synthetic/medicinal chemistry background) would also be considered if they have more than 3 years working full-time as an analytical chemist; � Evidence of ability to lead projects as a project manager with previous supervisory experience desirable; � Able to forge close working relationships with other departments, particularly Chemistry; � Significant experience of purifying small organic molecules as singletons and libraries of compounds, ideally in 96 (or higher)-well plate format; � Keen to work practically in a lab, setting up the Department from scratch and maintaining instrumentation once the Department is established; � Fluency in verbal and written English.

Contract writer in the chiral technologies area

D&MD Publications is seeking a qualified individual to prepare a market analysis report on the chirals industry. The candidate must have experience in the chirals field with a business perspective, solid researching and writing skills, and be able to meet deadlines.

Mr.

Dear Sirs, We are offering a PhD in organic chemistry full or part time to enter a very exciting project where the outcome can be highly profitable. Our idea and method is Patent Pending in the USA and concerns a SunBlocker compound and method which will be absolutely ideal and useful for children & parents. We are willing to allow the appropriate candidate to work on this project part-time and we are offering a share of it, which should result in substantial profits on a short term basis. We could as things are now, sell the idea to the major manufacturers in the SunCare field, or we could find the ultimate compound and sell it for even more. In order to carry out the second option, we needd the help from an expert PhD in this field. We invite all interested parties to contact us, but please only serious candidates. Thank you. Kind regards, CIL Group

R&D Manager

Design and execution of experiments for custom synthesis of building blocks of amino acid chemistry and chiral intermediates. Also shall be heading a 10 member team. Selected individual will have more than 5 years experience in our technology and industry.

Scientist 11- Research and Preclinical development

Mass Spectrometrist to do research with proteomics. Candidate must develop and apply state of the art proteomics to research in areas such as neurobiology and immunopathology. Duties will include operation of ThermoFinnigan, LTQ-FT and LCQ DECA XP and ABI Q_Star mass spect. Must have strong background in proteomics including nanoLC-MS/MS and Maldi. High throughput screen and quantitative mass spect a must.

Director of Risk management

Our client is a global, publicly traded, research-based company that discovers, develops, manufactures and markets a broad range of Pharmaceutical products. Job Description: * Direct all risk management functions globally * Responsible for all major insurance policies including property, business interruption, liability, product liability, clinical trial, D&O, automotive and workers compensation. * Research, develop and implement renewal strategies including cost saving and risk mitigation initiatives. * Research, collect, analyze, organize, and submit underwriting data. * Manage insurance brokers and make proper recommendations to executive management. * Manage ex-US insurance programs which comply with local laws and regulations while meeting overall corporate needs. * Create and maintain a standardized insurance reporting, compliance and risk management program. Education/Skills Required: * BA/BS degree Business and/or Sciences * MBA or advanced Degree / Certifications highly preferred Qualifications Required: * 10 years experience in risk management or with insurance company or broker, * Preferably with knowledge and experience in the pharmaceutical/biotechnology industry including product liability and clinical trial insurance exposure * Experience with property/casualty as well as D&O insurance. * Expert level research skills required to develop international risk strategies. * Identifies alternative approaches to risk management problems. * Collaborates well within and outside department function. * Good written and verbal communication skills.

JR CHEMIST - QUALITY CONTROL

JOB DESCRIPTIONS: 1. Laboratory In-Charge on Haridwar Zinc Plant To maintain total laboratory instruments, Equipments correctly, and maintain the house keeping and ensure the Safe disposal of wastage analysed chemicals, ISO and LME documentations, daily analysis ( FG Zinc Ingots, Bath samples, Raw materials, Ammonium chloride, Zinc scraps, Zinc Dross, Water analysis, Wastage Solutions) records, Reference manuals etc., No accident and incident in Lab. 2. Quality In-Charge on Haridwar Zinc Plant 100% accurate Analysis on timely and to accurate data should be entering in the SAP. To cooperate with production peoples for improve the Quality of FG, here we are produced max SHG Zinc Ingots only. 3. ISO Certifications and LME Registrations To prepared total Laboratory ISO documents on Haridwar Zinc Plant and to cooperate with the LME Registrations Successfully. ACHIEVEMENTS: Higher levels of excellence in the areas of sampling, analysis and reporting. This document focuses on accuracy, repeatability and reproducibility of Laboratory results produced from the analysis of raw materials, process samples and finished products to ensure that the methods of sampling, analysis and the data generated are of a sufficiently high standard to stand external Scrutiny. Quality Control Laboratory has to comply with National and International standards like ISO, BIS, ASTM and LME, Specific Customer requirements etc. depending on the final products being manufactured and also the Specifications for metals and other in-process control parameters. It is essential, therefore, that Laboratory engaged in the development and use of methods of sampling and analysis of all incoming raw materials, process samples and finished goods.

TECHNICAL/MARKETING WRITER

You must have MS in chemistry or closely related area, knowledge of cheminformatics, medicinal chemistry or pharmacokinetics, native English command language, proven experience as a scientific writer, editor or content manager, the ability to quickly and effectively develop new technical and scientific materials, work unsupervised, efficiently communicate with overseas developers. Exposure to pharmaceutical research or the drug discovery and development process is a plus. Responsibilities will include creating/proofreading technical and scientific/marketing materials for our software manuals, web articles, e-newsletters, application notes and case studies of using our software in various R & D areas, researching inside and outside information, and interviewing customers. Relocation not required (work from home while being in close contact with Marketing and Development).

sales assist

Assist sales people in selling esoteric testing service to hospitals. Requires a Ph.D. in chemistry, microbiology, immunology or medical technology. Must have several years? hospital laboratory experience. Must be willing to travel.

Sr. Scientist, Drug Formulation

Title: Manager, Aerosol Formulation - 200444 Description: The successful candidate will play a key role in the implementation of a comprehensive drug delivery strategy for Corus products. Reporting to the Director of Inhalation Technology, this person will be responsible for optimizing the drug delivery performance of Corus' respiratory products. This work will focus on the interaction between drug formulations and devices, and involve collaboration with Corus Research and Manufacturing groups as well as external formulation development and testing contractors. Essential Functions of the Position: Lead the development effort to optimize formulations for the chosen delivery system for Corus respiratory products. Support Research department with formulation characterization (physical properties, stability, etc,) of feasibility programs. Manage internal teams and external formulation development organizations. Contribute to clinical and regulatory documentation. Some travel required. Qualifications: Minumum B.S. in Chemical Engineering, Chemistry, or equivalent. At least 8 years industrial experience in formulation development. Experience with liquid inhalation formulations a must, dry powder formulations desired. Excellent analysis and communication skills. Ability to work well in a team environment.

Solid Dosage Formulation Chemists/Scientists

Job Description Develop/Formulate new or improve existing solid dosage (OTC and vitamins) manufacturing products and processes to produce highest quality products in a cost efficient manner. Conduct engineering studies, Value Engineering Products, conduct and monitor scale ups. Submit samples for stability from scale ups, analyze data and write reports, evaluate and approve raw materials. Identify more cost effective raw materials without sacrificing the quality of the product Develop products and process controls to increase quality and efficiency in manufacturing. Provide hands-on expertise to ensure reliable and reproducible quality content in all products and processes. Generate and approve Raw Material Specifications, Master Formulas, Bulk Specs, Process Validation, Protocols and Specifications. Assist in technology development and transfer of technology to production. Provide shop floor support. Resolve all quality issues of finished products through regular interaction with QC/QA. Investigate IR issues and take corrective action to prevent recurrence. Develop rework or reprocessing instructions as required. Develop SOP’s and training as needed. Implement and follow up on company policies and safety issues. Perform other job related duties as assigned. Requirements Minimum BS degree in a Science related field such as Chemistry, Chemical Engineering or Pharmaceutical Chemistry/Engineering. 7+ years hands-on solid dosage (tablet, hard-shell capsule) formulation experience or process engineering in the Vitamin, OTC or Pharmaceutical industry. Experience should be in Tech Ops or R&D with a good understanding of shop floor processes. Must have Fluid Bed and High Sheer granulation experience. Must have experience with Pilot Plant processes and test equipment (physical), instruments, GLP’s and methods development. Knowledge of cGMP and FDA requirements is a must. SUPAK experience is a plus. Must have excellent technical writing skills as well as communication skills, statistical process control and documentation. Must be able to effectively communicate with all levels. Microsoft Office Application skills are required. Experience in NDA/ANDA submissions is a plus. NOTE: The positions in California are focused on VMS. Granulation experience is not required but could be helpful.

Nurses (IELTS & CGFNS Cleared)

We require Nurses (IELTS and CGNFS cleared) and Speech Therapist (Masters, TOEFL & TSE Cleared) and for UK/ USA/ Australia.

Speech Therapists (Masters, TOEFL & TSE Cleared)

We require Speech Therapist (Masters, TOEFL & TSE Cleared) and Nurses (IELTS and CGNFS cleared) for UK/ USA/ Australia.

Chemistry & Materials Section Supervisor

Responsible for technical and administrative supervision of 30 personnel in the Chemistry & Materials Section of the Laboratories Department. Ensure planning for and execution of Chemistry & Materials Section mission. Requires budget planning and maintenance, direction and approval of technical activities, along with personnel selection and management. Responsible for ensuring the effective use of project management tools for the CMS section budget and projects. Will work closely with counterparts to maintain quality of product and timeliness of delivery. Provides open communication with CMS section personnel and coaching and mentoring as required. Ensures CMS operations mesh with overall Laboratories Department objectives. Functions as Certifying Official for Training Classifications owned by the CMS section. As an Equal Opportunity Employer, we are committed to a diverse workforce Qualified applicants will have a Bachelor's Degree (or higher) in Chemistry and/or Materials Science and at least five years of directly applicable experience, including direct supervision in a laboratory setting. Excellent communication and interpersonal skills are required. Must be able to pass a physical examination consistent with the requirements of the position as determined by the company.

Bilingual Sales Representatives

Bilingual Sales Representatives - Torrance, CaliforniaI am assisting to recruit a Bilingual Inside Sales Representative for a biochemical company located in Torrance, California.COMPANY:They are an international, technology-based company specializing in the production of innovative biochemical and pharmaceutical compounds. This position is within the division that has scientific know-how in peptide conjugation, antibody production (against peptides and proteins) for immunoassay, immunohistochemistry and immunocytochemistry, kit formulation and iodination of peptides. The company employs 530 motivated and qualified people worldwide.This position will report to the Director, Product Services and will be responsible for selling the company's products and services by contacting prospective and established customers. The Sales Representative will follow up on leads and establish close customer contacts to promote the company's products to select accounts as designated by Sales Management.ESSENTIAL FUNCTIONS:

NMR Scientist

My client is seeking a self-motivated individual with a scientific background in small-molecule NMR spectroscopy as a NMR system administrator/operator to support their pre-clinical and clinical Drug Discovery programs. The successful candidate will be expected to support the on-going activities of our Medicinal Chemistry Drug Discovery group, including administration, routine maintenance and trouble-shooting of our open-access 300 and dedicated 600 MHz NMR instruments. Specific responsibilities include the use of multinuclear 1D and 2D NMR spectroscopy to characterize the structure of novel chemical entities, including those derived from natural products, as well as characterization of chemical impurities and metabolites in both Drug Discovery and Development settings, and subsequent data reduction and reporting to our project teams and for inclusion in regulatory filings. Candidates should be able to work independently, demonstrate good organizational and strong interpersonal skills. Excellent written and presentation skills are essential. Candidates should have an MS or equivalent degree in Chemistry or equivalent discipline, as well as 3+ years of relevant work experience in NMR spectroscopy and NMR system administration, preferably in a multi-user open access setting. Experience with Bruker NMR systems is an advantage.

Research Analyst

We have openings for the post of Research Analyst and teaching in the field of Bioinformatics.

Business Development

Our client, a successful and exciting small multinational, requires a Business Development manager with industry experience in Medicinal Chemistry to undertake a strategic role within the company. The person will have proven experience in business development, an ability to articulate corporate vision, and a high standard of knowledge in Medicinal Chemistry. The role requires a PhD, an instigator able to negotiate, and a strong desire to succeed. Location of the role is the candidate's choice of the USA or Europe.

MSc. Candidate

They want a person with at least 5 years of experience, but not a Ph.D. Tight job market!

Medicinal Chemistry Research Associate

BSc MSc level Medicinal Chemist. Small molecule drug discovery @ GPCRs

VP (R&D)

1. To Plan and develop efficient process for manufacture of exiting Molecules and guide, supervise all the R & D activities. � To develop process for New Molecules and Scale up implementation from laboratory level to commercial production level. � To stabilize processes to optimize and standardize reaction conditions. � To prepare process transfer technology docket. � To identify problems ? deviations in reaction conditions and trouble-shoot and improve the process of the exiting commercialized products. � To actively contribute in the process of selection of New molecules for development and its economic feasibility and assessment of suitability and capability of the existing plant and processes. � To participate and contribute to activities related to patents which include necessary date filling, drafting and developing non-infringing processes. � To contribute effectively to improve Customer satisfaction, their specific requirements more particularly related to impurities levels, preparation of samples. � To assist in the preparation of raw material and intermediates specifications. � To be involved with all activities related to Custom Synthesis more specially co-ordinate of

bioinformatician(Drug discovery)

Structure based drug design Rational drug design protein modeling

SENIOR SCIENTIST

This is an amazing salary for India.They want a US experienced person for their team in India.EXPERIENCE IN MULTI STEP SYNTHESIS AND NOTABLE TRACK RECORD OF SCIENTIFIC ACHIEVEMENTSAT LEAST 1-3 DRUG DISCOVERY RESEARCH EXPERIENCE IN AN INDUSTRIAL PHARMACEUTICAL SETTING.Development of Non-Infringing routes for APIs / intermediates.developing Dossiers for registration in developed Countries of Europe, Australia, New Zealand, Brazil and gearing up for filing of ANDA�?�?�?�?�?�?�?�?�?�?�?�?�?�?�?¢�?�?�?�?�?�?�?�?�?�?�?�?�?�?�?¤�?�?�?�?�?�?�?�?�?�?�?�?�?�?�?�?s in USA.

Analytical chemist

High Performance Liquid Chromatography (HPLC), Gas Chromatography (GC), Infrared Radiation (IR), Atomic absorption, Ultraviolet (UV) radiation and Electrochemical Analysis.

reserch scientist

method development and validation as per ich

Clinical Marketing and Sales

Pharmaceutical Industry seeks a top notch Marketing Professional for the above mentioned slot. They are a Research and testing Services Company with world - class quality standards. Their vision is to be among top 10 contract research and testing organizations globally by 2010 Job Description *Candidate will be responsible for the overall Marketing of Clinical Reference Lab Services of the company. *As Profit Centre Head, the responsibilities include Sales plan, Territory mapping, Decision making, Achieving the Targets for Revenue and collection, Sales force training and management, Patient Service Center management, etc., Desired Profile *The candidate should have around 10 - 15 years of track record in a Senior Management position. *The candidate should have extensive sales knowledge and work experience relating to marketing of Lab services on Pathology, on all India basis. *The candidate needs to travel at least 20 days in a month. *The Candidate should be extremely strong in communication, interpersonal and leadership skills. *The candidate should also have experience in people management as well as the management of performance from fellow colleagues. *Qualifications: Post Graduate in Bio-Sciences/ M.B.B.S/ M.D. or Ph D., in Pathology. A post graduate degree in Management will be preferred. Age range: 35 - 40 years Minimum Experience: 12 years Maximum Experience: 16 years Remuneration: Best in Industry, inclusive of performance incentive. Location: Andhra Pradesh - Hyderabad / Secunderabad, (However, transferable to any place in India.)

Senior Manager R&D

Complete in charge for Quality Control (QC) & Research and Development (R&D). Knowledge of Good Laboratory Practice (GLP) Requirements. Method development & Preparation of Dossiers & Knowledge in handling instruments High Performance Liquid Chromatography (HPLC), GLC, High performance thin layer chromatography (HPTLC), etc. Minimum of 15 years experience required.

Research Associates-Organic Chemistry

Seeking 3 Research Associates-Organic Chemistry Synthesis, characterization and study of nitrogen heterocycles or other small molecules of interest for antiviral activity. The Laboratory is located in Montpellier, south of France where there is already a group of 30 scientists and technicians exclusively dedicated to drug discovery chemistry.

Group Leader Medicinal Chemistry

Reports to: Vice President, Chemistry Summary and Scope of Position: The Group Leader - Medicinal Chemistry ensures the delivery of high quality drug development candidates within competitive timeframes and with optimal medicinal chemistry contributions at high scientific standards in all assigned drug discovery projects. The Group Leader - Medicinal Chemistry effectively manages and leads the reporting medicinal chemistry group and develops the capabilities of the staff and the chemistry technology platform. Managerial Responsibilities. * Manage a medicinal chemistry group of up to 10 PhD level scientists and MSc or BA level research associates within ongoing hit to lead or lead optimization projects. Provide performance feedback, create and implement development plans for subordinates in collaboration with Vice President, Chemistry. * Determine key requirements of subordinate positions and recruit and evaluate candidates for staff roles together with Vice President Chemistry and HR. Participate in the strategic planning and development of the Chemistry Department as a member of the Chemistry Management Team, to ensure the highest standard of the medicinal chemistry contribution to the projects. Coordinate medicinal and/or synthetic organic chemistry outsourcing activities or collaborations within assigned projects if relevant. Scientific Responsibilities. * Manage all medicinal chemistry activities in assigned projects ensuring the delivery of high quality development candidates within competitive timeframes. * Resolve medicinal chemistry related patent issues within assigned projects, including developing and executing a strategy in close collaboration with Patent attorneys, to ensure optimal protection of medicinal chemistry related IPR. * Coach and advise subordinates in medicinal, synthetic and organic chemistry issues to ensure high quality contribution to assigned projects. * Participate in the development of the synthetic and analytical chemistry technology platform to ensure efficient synthesis, purification and analysis of single compounds, compound series and libraries. * Ensure high quality communication of medicinal chemistry issues at the project team meetings and in reports. Ensure documentation of performed scientific work according to good scientific, practical and SNAP/LU guidelines. Other Responsibilities. Ensure the group maintains the highest laboratory safety standards. Hold group members accountable for safety in their area. Ensure any lab modifications enhance safety. * Ensure a strong network and visibility of Synaptic and Lundbeck in the medicinal and synthetic organic chemistry field by participation in scientific meetings and by developing and delivering high quality publications and presentations. Educational Requirements. PhD and PostDoc in synthetic organic chemistry required. Experience. * 10 years medicinal chemistry and drug discovery industrial experience is required. Experience with all phases of drug discovery from hit identification to delivery of development candidate, using state off the art (automated) parallel synthesis technologies also required. * Track record of significant scientific contributions with publications in peer-reviewed journals and patents is essential. * Experience effectively managing, supervising or leading other professionals strongly preferred. * Medicinal chemistry experience with GPCRs in the CNS field, and a demonstrated track record of delivery of high quality drug development candidates preferred. * Additionally, strong interpersonal and influencing skills, and comfort working in a changing environment is beneficial.

bioinformatician(Drug discovery)

Structure based drug design Rational drug design protein modeling

for research associate

RESEARCH ASSOCIATE

medicinal and computational job #20170

R&D Q.C

GC/MS Chemist

Kelly Scientific Resources, the scientific division of Kelly Services, is seeking a GC/MS Analyst for a leading environmental testing lab in the San Antonio area. This position will be responsible for conducting routine and non-routine analysis of environmental samples using gas chromatography (GC) techniques and a variety of detectors, including flame ionization detectors (FID) and mass spectrometers. Specific tests to be performed include total petroleum hydrocarbons and volatile organic compounds (EPA Method 524 or 624). Analyst will be responsible for conducting tests start to finish (i.e. - sample prep, extractions, data entry and review). Depending on level of experience, this position could be direct hire or temp-to-hire with a salary range of $38-45K. The analyst will work under limited supervision, therefore, previous hands-on experience is a must. Other Responsibilities Include: 'Prepares samples for analysis. Uses manual and automated sample introduction techniques. Acquires, interprets, reduces, evaluates, summarizes, reports and archives the resulting data. 'Follows published analytical methods and internal standard operating procedures. 'Observes good laboratory practices, adheres to policies and procedures set forth in the laboratory's Quality Assurance Manual, and complies with the latest version of the National Environmental Laboratory Accreditation Program (NELAP) standard. Maintains all applicable documentation. 'Performs routine instrument maintenance and troubleshooting. Requirements: 'BS in Chemistry is preferred with at least one year of direct GC/MS analysis experience 'Prefer two years experience of full-time GC/MS experience analyzing environmental samples for volatile organic compounds, BTEX, and/or petroleum related analysis, using Hewlett Packard/Agilent instrumentation and Chemstation Software Kelly Scientific Resources is recognized as the world leader in the scientific staffing industry. Our recruiters are scientists themselves with prior industry experience. We offer a competitive benefit package including access to individual health plans and a retirement savings program. We provide scientific staffing services on a temporary, temp to hire, and full-time basis to a broad spectrum of industries including Chemical, Environmental, Food Science, Pharmaceutical, and Biotechnology. Kelly Services is an Equal Opportunity Employer.

Calling Bsc Chemistry Freshers

Wanted Freshers (Unmarried Male Candidates only)from BSc Chemistry - 2008/2009 Batches for a Service and Marketing position in a reputed Organization in Saudi Arabia. Send in your resumes to rakesh.rajagopalan@yahoo.com

Formulation Analyst

I have completed my M.Sc in Agrochemicals and Pest Management from University of Delhi in June 2009.I have the Knowledge of Pesticide formulation, Emulsion stability test, HPLC, GC,and IR.

Part time consultants in chemistry and biology

CHEMISTRY TOTAL SYNTHESIS EXPERTS WITH PHD; THE INTELLIGENCE GRID New Drug Discovery has become an expensive proposition for pharmaceutical companies. Projects get stalled in an internal laboratory causing valuable man hours and dollars to be burnt without any breakthroughs. We invite exceptionally bright, intelligent Masters, PhDs and Post-PhD scientists to join our Intelligence Grid. If you are a subject matter expert in biochemistry, chemistry, toxicology, pharmacology, computational biology or any related subject areas, we need your help wherever you might be in the world. You will involve yourself in problem solving across 114 different areas of Pre-Clinical Discovery working for small as well as large pharmaceutical companies from the comfort of your computer workstation. You will be connected to our grid, solve a problem and be compensated for it. There is no need to relocate, change jobs or change your present career path. You will find involvement with us intellectually and monetarily fulfilling. There are no age restrictions. We welcome senior and retired scientists to the grid. Interested? Please email your resumes to TheIntelligenceGrid@gmail.com

Senior Chemist/Group Leader (Synthetic Chemistry)

The candidate is expected to provide leadership to the R&D program, and personally supervise and execute all projects. Usual projects include API process development for DMF filing, non infringing processes, Amino Acid precursors and derivatives, Preclinical NCE process development,chiral molecules, high value intermediates, complex chemistry, etc.

B.SC (CHEMISTRY)PASSED OUT IN, 2003OR 2004 OR 2005

FRESHER

Drug Desigining

computer Aided Drug Desigining

BIOCHEMIST

pharmaceucticaljob of biotech

pharma job of biotech

Sr.Research officer

Q.C/Q.A Manager

Drug desigining , Molecular Modelling

computer aided drug desigining

drug desigining

computer aided drug desigining and molecular modelling

drug desigining

computer aided drug desigining

Surface Chemist

Experience the thrill of working on the cutting edge! Our client, a leader in microbial genome analysis, is seeking talented individuals to join their team as they develop and commercialize Optical Mapping: an enabling technology for "whole genome" analysis. This position is the perfect opportunity for a self-motivated individual to contribute to state-of-the-art research and development, employ cutting-edge technologies, and work with experts in the fields of Genetics, Chemistry, and Computational Biology. Surface Chemist Madison, WI As part of our client's multi-disciplinary R&D team, you'll play a key role in the development of novel lab-on-chip devices. Qualified applicants will have an advanced degree or equivalent industry experience in Physical Chemistry/Chemical Engineering/Physics or a related discipline and a minimum of two years' experience. Expertise in producing functionalized surfaces for interaction with biomolecules, particularly DNA, is highly preferred, as well as prior experience in commercial R&D and familiarity with microfluidic systems, ideally in a rapid prototyping/testing environment. The successful candidate for this position will initially work in Madison, Wisconsin, but will be expected to relocate to another facility in the near future. Careers with our client offer competitive salaries and benefits, as well as excellent opportunities for professional growth. Apply today by sending your resume, attached as a Word document, to: thanson@rci-together.com. You can also call 561-277-1258 for more information. Equal Opportunity Employer. RCI Recruitment Solutions is a privately owned firm headquartered in Jupiter, Florida, with operations throughout the United States. For over 35 years, RCI has provided a wide range of candidate sourcing and related recruitment services. Its proprietary and client-specific solutions encompass a variety of services, including advertising, consulting, media services, and staffing technology.

QC Chemist

Align with experience. You?re a leader looking for a career that challenges you professionally and personally. You?re looking for a company that really believes that investing in people is the key to future success. Over the last 100+ years, our client company has found that producing the highest quality pharmaceutical products requires employees with exceptional skills - leadership, flexibility, commitment and technical expertise. Talent is key - and so is teamwork. Their employees work in team environments where quality and customer service is a way of life. If you'd like to be a part of our client's continuing tradition of innovation and progress, consider joining their team in the following role: Chemist, Quality Control Norwich, NY In this position, you'll perform routine testing to assess the conformance of raw materials, finished products, and stability samples to predetermined product specifications. In support of manufacturing, packaging, or product development efforts, you may also be required to test samples for cleaning verification or process/method validation. To qualify, you'll need a BS degree in Chemistry or a related field, two to three years of relevant experience, and basic knowledge of SOPs and GMP regulations as related to the pharmaceutical quality control laboratory. If you possess strong skills, a commitment to excellence, and a desire to contribute to our client's vital, growing organization, we?d like to learn more about you. A respected name in pharmaceuticals for more than a century, our client company offers a superior benefits package that includes health, dental, vision, and life insurance, short- and long-term disability, paid time off, paid vacations, paid holidays, 401(k), a bonus plan, and more. Apply for this exciting career opportunity today by sending your resume, attached as a Word document, to: tfrank@rci-together.com. You can also call 336-918-1860 for more information. Equal Opportunity Employer. RCI Recruitment Solutions is a privately owned firm headquartered in Jupiter, Florida, with operations throughout the United States. For over 35 years, RCI has provided a wide range of candidate sourcing and related recruitment services. Its proprietary and client-specific solutions encompass a variety of services, including advertising, consulting, media services, and staffing technology.

Drug designing

Structure Based Drug designing and Molecular Modelling

research associate

currently i am doing cro work

VP Medicinal Pet Foods Research & Development

Will lead a team of scientists in new product development and applications of new technologies and nutritinal ingredients to pet food and animal feed products for this major international processor.

Senior Drug Discovery Applications Scientist

I am assisting to recruit a Senior Drug Discovery Applications Scientist for a client with offices in Oregon, California and New York. This client is recognized as a high-growth leader in the development and delivery computational methods for drug discovery and development. This company offers excellent compensation and generous benefits. Here is more information: They are seeking a scientist for their Drug Discovery Applications Group. The successful candidate will become part of a multidisciplinary drug discovery team working on both in-house efforts to improve and apply drug discovery methodologies and on collaborative projects with pharmaceutical/biotechnology partners. Job Description: Actively participate in Drug Discovery Applications Group projects Apply drug discovery software and perform analysis of the results Effectively communicate results to other members of the Group Work closely with the Development Team to test and improve Drug Discovery technologies Essential Qualifications and Experience: Ph.D. in computational chemistry, organic chemistry, or biochemistry Computational experience in at least 1 of the following areas: molecular modeling, structure-based drug design, virtual ligand screening, computationally-driven lead optimization, ligand-based design, or homology modeling Excellent verbal and written communication skills Ability to work independently Desirable Skills: Programming skills: Perl script writing, in particular. Experience with chemical databases Benefits include: Medical, Dental, 401K, Flexible Spending Account, 3+ weeks vacation and tuition reimbursement. What do you think? Post your resume. It is important to use the position title as the subject of your email to enable your resume to reach me as quickly as possible. If you aren't interested or feel you are not qualified, do you know anyone who would be interested? We do offer generous referral fees. Thanks for your time and have a great day!

master of pharmacy

R. and D., Q.A., Q.C., Regulatory affaire

Analytical Chemist

Duties Include: Planning and carrying out chemistry & quality control activities. Performing analytical methods development/validation on raw material and/or finished products. Performing analyses requiring knowledge of analytical method development for assay and impurities of APD and finished product; dissolution methods development for immediate release and modified release oral solid dosage forms; and impurity profiling of finished products. Requirements: BS in Chemistry. MUST have at least 2+ years in GMP pharmaceutical experience. Must have lab skills in pharmaceutical analysis. Experience with HPLC, GC, and a variety of analytical instruments within a pharmaceutical setting is required. Experience with Waters HPLC or GC is a PLUS!

Chemistryand Bio-informatics based jobs

manager

hardworking for the company

Senior Scientist, Cell Biology

Headway LifeSciences Resources currently assisting a leading tissue engineering/regenerative medicine organization with their search for a Sr. Scientist/Cell Biologist to join their innovative R&D group located in Winston-Salem, NC! We are specifically seeking a PhD with experience in understanding the role of ECM proteins in cellular differentiation and tissue regeneration processes and specific knowledge of the processes involved in ECM disposition, preferably on biomaterials. The Sr. Scientist will be responsible for designing and executing experiments focused on optimizing the production of ECM proteins in tissue engineered constructs, antigenic and molecular characterization of cells attached to biomaterials and participating in team efforts focusing on the functional integrity of cell-seeded biomaterials and scaffolds. This is a fantastic opportunity to join a leader in tissue engineering. This position offers a highly competitive salary and benefits package and the ability to work on cutting-edge research. Qualifications include PhD with 3-5 years of experience cell biology, biochemistry or related Demonstrated expertise in extracellular matrix biology and biochemistry, glycoprotein isolation and characterization Knowledge of processes involved in extracellular matrix deposition, preferably on biomaterials Experience in defining optimal growth and differentiation parameters of in models for tissue engineering Experience in designing and conducting experimental strategies to assess functional integrity of cells on biomaterials For immediate and confidential consideration, please forward a copy of your CV to kmccahan@headwaycorp.com or call (919) 424-1145. EEO/AA/M/F/V/D

Need M.Sc.,Chemistry Job

R&D,Quality Checking

M.Sc.,Chemistry Job

R&D , QC

Computational and medicinal chemist

Our company is a French startup engaged in commercializing innovative software and services dedicated to R&D in drug discovery. Nova Decision is based in the south of France at Montpellier (150 km from Marseille). The successful candidate will implement and drive Computational and Medicinal Chemistry strategy for our internal projects and for our customers' drug discovery projects in hit finding, hit-to-lead and lead optimization stages, in order to deliver the highest standards of medicinal chemistry for the company. He/She will contribute to the broader strategy of chemoinformatics in the field of structure based drug design. He/She will collaborate across all discovery groups in house or at customers' side (such as Medicinal Chemistry, HTS, in vitro pharmacology, Metabolism and Pharmacokinetics). Qualified candidates will have a PhD in computational chemistry, molecular modelling or related fields with a strong background and know-how in medicinal chemistry. He/She should have in-depth knowledge and expertise in more than one of the following areas: pharmacophore generation, small molecule modelling, 2D/3D QSAR, docking and scoring, virtual screening, de novo and ligand design methods, lead hopping, homology modelling and HTS analysis. We are seeking individuals with excellent communication skills who are creative, organized, enthusiastic, independent problem solver with excellent critical thinking skills and who are able to work effectively in a multidisciplinary discovery team environment.

Life Science Recruiter

Life Science Recruiter ? Raleigh, NC Headway Corporate Resources seeking entry-level Life Science Recruiter for a full-time position located in Raleigh, NC! Responsibilities: Sourcing, recruiting screening, interviewing and selecting professionals for related life science employment opportunities. Networking and business development required. Reviews resumes and evaluates work history, education and training, job skills, compensation requirements, and other qualifications of applicants. Maintains electronic records in applicant tracking system pertaining to applicants and job orders. Performs reference checks, background screening, education verification, certification and license verification, and skills testing. Requirements: Attention to detail, excellent interpersonal communication skills, and proficiency in Outlook, Word, and Excel. Experience in a recruiting capacity preferred but not required. Strong sales experience with nice aggression and understanding of life sciences preferred. Bachelor?s degree in a life science related major or scientific (pharma, biotech, medical) job experience preferred. Benefits: Health, dental, vision, life, 401k, sick and vacation leave. Interested candidates should send resume and salary requirements to HRCLS5@headwaycorp.com or apply online at www.headwaycorp.com/jobs EEO/AA/M/F/V/D

We are seeking a self-motivated, creative and independent thinking individual for a Process Engineer position. In this role, you will be a member of the Process R&D team and will make important contributions to the development and scale-up of pharmaceutical compounds. You will conduct process development studies and support production activities in our new kilo-laboratory facility. Qualified candidates will have a BS in Chemical Engineering with 1-3 years of experience in the chemical/pharmaceutical industry. Familiarity with GMP is a plus. The ability to work independently in the laboratory is essential. Strong organization and communication skills are required

Riyadh

chemistry based job

FRESHER CHEMIST

CHEMIST JOB

Research Scientist / Senior scientist

Position open for a Ph. D. in computational chemisttry or molecular biophysics, well-versed in molecular modeling techniques (pharmacophore modeling, QSAR, docking and scoring). Excellent opportunity in a rapidly growing computational group with diverse skill set, interacting with medicinal chemistry, structural biology and other teams in pre-clinical drug development. Friendly job atmosphere. Good communication skills and publication record required.

analytical chemist

mr

good for busines

RESEACH ASSOCITE

i have completed my M.Sc(organic chemisry)

Head NCE formulation

Position / designation : Head- NCE Formulation Location : Mumbai Essential qualifications : Ph.D. (Pharmaceutical Science or relevant field) Experience : 5 - 7 years Should have worked on the formulations of NCE molecules for 5+ years at US or Europe based company. Should have exposure to in early development (in Preformulation / formulation design and development of NCEs up to and including clinical manufacturing & the support of Phase-One IND submissions) Other competencies required (If any) : ? Good communication & interpersonal skills, ? Ability to supervise, coach & mentor and a track record of effective contribution to & leadership of various projects. ? ?Understanding? of analytical support of formulation development, not necessarily core strength though ? Exposure to Preformulation will be a plus. ? Project planning ? Computer skills Brief Job Description : ? Incumbent shall Head the NCE Formulations Group that performs Preformulation, Formulation Design, Analytical and Stability Studies and Clinical Manufacturing of Early Development of NCEs (upto Phase-I and POC type batches) for our NCEs. ? Shall manage Scientists, Budgets, Infrastructure and resources to deliver on set objectives. ? Should have experience in early development (in the formulation of NCEs including clinical manufacturing). Preferred age group : 30 ? 45 years Compensation package : Shall be according to experience and industry standards Reporting Authority : President ? Pharma R & D

head-QC/QA/RA/MKG

AS SUITABLE OF ABOVE( FOR BULK DRUGS&PHARMULATIONS)

Senior CRA

Urgent requirement for one of our top clients located in ?Mountain View, CA ?. Please contact me at your earliest convenience, along with job No. SCRA_113007 to anitha.maturi@makrotech.com Description: Monitor clinical trials, study sites, and clinical data. Ensure compliance with protocol and overall clinical objectives and GCP. Provide project support to clinical programs with minimum supervision. Interfaces with all project/clinical groups and off-site personnel as needed in support of project and departmental goals and responsibilities. Manage clinical study sites including study site start up and close-out. Ensure study sites follow Company?s SOPs and GCP. Assist in management of relationships with vendors within and across studies. Provide mentoring and work leadership to junior CRAs. Assist in development of clinical study protocols and take ownership of their implementation where appropriate. Monitoring of clinical study sites (CRO staff) as required Ensures identified clinical study issues are resolved; implements and monitors corrective action. Provide input into development of Case Report Forms. Requirements Bachelor's degree or equivalent. RN with evidence of further study considered. Major course of study in Science or Health-related preferred. Training & Experience: 5 years experience in Clinical Research or related field. MUST be proficient in Microsoft Office/Windows, and Microsoft Outlook. Specifically: MS Word, MS Excel, MS Powerpoint and MS Project with excellent oral and written communication skills. Demonstrates good understanding of ICH/GCP, and US FDA regulations as applied to clinical research. Contact: The most effective way of communication is via email please forward us your updated WORD FORMAT resume (Address, Contact number and email is must) to *** anitha.maturi@makrotech.com *** Please mention your best hourly rate, availability and visa status. Any questions, do feel free to email us.

bioinformatician

drug desiging

Bio-tech

Development and co-ordination of long term MDX strategy Liase specific strategic alignment across all relevant portfolio teams Active role in MDX portfolio team Maintain and monitor the market dynamics Execute strategic initiatives in support of MD business Major contribution to drive decisions in MDX business Technical background on molecular diagnostic applications Fluent in English and German desirable Proven project management experience

Biostatistician

BIOSTATISTICIAN JOB DESCRIPTION Job title: Biostatistician Supervisor: Manager Informatics Department: Informatics FLSA Status: Exempt Our Client Company is offering an outstanding opportunity for a biostatistician looking for a unique career in a well funded, rapidly growing startup. We are a is a medical device company developing novel health monitoring technologies. Position Description The successful candidate will take part in two primary projects, device and assay development and statistical algorithm development forming the basis of the company's informatics offerings. Skills and Responsibilities: As part of a product development or assessment team, collaborates in the preparation and review of clinical trial result assessments. Provide strategic input into the clinical trial development plan. For assigned clinical trial development project(s), provides sound strategic, statistical and scientific input on project objectives, experimental design, and data analysis to meet project needs and FDA statistical and scientific requirements. Review all project protocols, author protocol statistical analysis sections and generate study randomizations. Leads team's development of study analysis plans. Assume leadership for the Biostatistics activities related to portions of specific project(s). Reviews case report forms to ensure that protocol objectives are met and project standards are maintained. Author statistical analysis results in the clinical study reports. The candidate will be responsible for seeing the report through review process and will represent the company at FDA meetings. The candidate will be responsible for statistical input to responses to FDA questions and for statistical content of presentations at Advisory Committee Meetings. The candidate will also assume statistical responsibility for major segments of a project, e.g. integrated safety/efficacy section of a BLA/NDA. Provides support for investigator publications. As part of the informatics team, the candidate will collaborate with the systems developers in creating analysis algorithms for mining data from databases -- internal, public and obtained private databases. The candidate should be familiar with sources of health-related databases. Should be familiar with statistical, data mining and machine learning technologies such as regression analysis, clustering, Bayesian filtering, forward and backward inferencing, and decision tree analysis Additionally, the candidate will encourage and contribute to discussion and preparation of publications and lectures on biometrics issues in clinical trials, both inside and outside of the company. The candidate will engages in research in statistics to improve clinical trial methodology used in the development of client products consistent with corporate priorities and timelines Requirements: Masters or Ph.D. in Statistics or Biostatistics 1+ years of industrial development experience. Software development skills, object-oriented development - Java, Perl or C++. Web development skills are a plus. Familiarity with statistical programming packages such as R, S, SAS, SPS Familiar with DBMS systems and the SQL language. Experience with MySQL is a plus. Experience in programming and building models using MATLAB a plus Candidate must possess strong communication skills in order to convey complex analytical results to business sponsors of programs

Senior Principal Investigator/Group Leader-Oncology

New JOBS! A very well regarded pharmaceutical company in suburban MA seeks a highly motivated scientists for the following positions. Main Tasks The successful candidate will lead a group of principal investigators and scientists within a dynamic, multi-disciplinary team in Oncology In Vivo Pharmacology. This group will support anti-cancer drug discovery efforts involving small molecules. The primary responsibilities of this position will be to provide scientific and strategic leadership in oncology in vivo pharmacology, supervise, lead, motivate, organize, and manage the group toward successful project progression for lead discovery, plan and present studies for multiple projects and assist project leaders in developing scientific and technical strategies in a matrix environment. Qualifications The successful candidate will possess a PhD with post-doctoral training in cancer biology or pharmacology plus 5 to 8 years of experience in oncology in vivo pharmacology in the biotech or pharma setting. He/she should have a comprehensive, in-depth knowledge of molecular and cellular determinants of cancer, strong in vivo pharmacology skills in oncology, and direct experience with in vivo models of cancer, such as xenograft, syngeneic, and orthotopic tumor models. Candidates should understand pharmacokinetic-pharmacodynamic relationships and late stage preclinical discovery of compounds to support clinical studies. Good oral and verbal communication skills and the ability to work in a cross-functional team environment are required. Understanding the drug discovery process is a must. Previous management/supervisory experience is required. PRINCIPAL INVESTIGATOR-ONCOLOGY Main Tasks The In Vivo Pharmacology Group is looking for a motivated Principal Investigator with experience in the development of biotherapeutics in the drug discovery setting and the validation and use of in vivo models of oncology. Because of our efforts in cancer drug discovery, this position is key to moving proteins through our discovery pipeline. Responsibilities include development of xenograft models as well as implementation of in vivo imaging techniques. These models will be used to study the effects of Lead candidates on tumor growth, angiogenesis and metastasis. The ability to work in a team environment within a matrix organization is essential, as the incumbent will participate on multidisciplinary project teams. Excellent communication skills, both written and verbal, are critical. Qualifications EDUCATION/LANGUAGES ? Candidates should have a Ph.D. in cancer biology or in vivo pharmacology and experience with development of protein therapeutics in drug discovery. In addition, knowledge of cancer signaling mechanisms is essential. Understanding of PK/PD relationships is desired but not required. Previous management and supervisory experience is a plus. Verbal and written fluency in and comprehension of English is required. PROFESSIONAL SKILLS & EXPERIENCE ?Two to three years of industry experience in the area of in vivo cancer biology or pharmacology is required. PERSONAL SKILLS & COMPETENCIES ? Candidates should be competent in the use of computer software for spreadsheets, presentations, word processing and statistical analysis. Good verbal and written communication skills are desirable, as well as the ability to work across functions in a team-oriented environment. This position is open to: For country residents only

Principal Investigator-cheminformatics

New Opportunity to work for a highly regarded pharmaceutical company in MA. Main Tasks ? Develop robust prediction models for the ADME/Toxicity properties (hERG, solubility, CYP inhibition, stability, BBB, etc) of small molecules with the estimation of confidence of these models. ? Interpret the calculated/predicted results to the medicinal chemists and help them to design new compounds. ? Perform docking or pharmacophore modeling based on crystal structures to support the lead optimization process. Qualifications The qualified candidate must have strong QSPR/QSAR background on small molecules. The candidate will have a Ph.D. degree in Chemistry (preferably organic or medicinal chemistry), Pharmacology, or closely related discipline along with more than five years of pharmaceutical discovery experience (experience in designing kinase inhibitors are desirable). The individual should have good oral and written communication and interpersonal skills. This position is open to: For country residents only Qualified candidates submit letter and CV to: candidates@biointegrationsearch.com

Product Manager, Biotech,Imaging Reagents and Systems

My client, a successful small Biotech company in the Boston Area is in need of a qualified Product Manager for their in-vivo imaging reagents and systems. Great working environment, competitive compensation and benefits Requirements: ? BS/MS Life Sciences ? 5+ years product management experience in the biotech industry in reagent and instrumentation products ? Strong presentation and written communication skills ? Knowledge of cell biology and biochemistry ? Ability to use Powerpoint and Excel programs ? Capable of understanding financial and legal documents as well as technical and scientific journals ? Ability too prepare presentations and articles for publications Description: ? Market research to define customer needs ? Analysis that directs product line through requirements ? Development of Market Strategy ? Assisting Management team in product line development ? Creation of sales tools ? Updating competitive information and relaying it to Sales management ? Preparation of marketing and sales materials ? Work with cross-functional teams for instrumentation and reagents ? Manage product testing and release activities ? Resolve issues to meet deadlines Open to US residents, Local residents who reside in the Boston area, who are eligible to work in the US. Sponsorship unavailable. Interested applicants should send a cover letter and resume to candidates@biointegrationsearch.com for immediate consideration. Must have 2years or more industry experience. US residents, only.

Scientist, Senior Scientist, Lead Discovery

An innovative startup biopharmaceutical company focused on discovering and developing new antibiotics directed at novel microbial targets. We are currently seeking a Scientist or Senior Scientist, Lead Discovery who will play a key role in designing and implementing the screening cascade for lead discovery and optimization. The successful candidate will report to the Director of Biology and will be responsible for developing and implementing biochemical and biological screens to facilitate the identification and optimization of antibiotic lead compounds. As the primary designee for compound screening, this individual will be an important and integral contributor to the success of our discovery and development program. This screening cascade will include proprietary in vitro ligand-RNA binding assays, bacterial activity assays, and mammalian cell culture assays designed to measure key optimization parameters. To carry out these tasks, the successful candidate will also be expected to assist with the recruiting, supervision, and professional development of junior-level scientists. Successful applicants are expected to have a Ph.D. in biochemistry, chemistry, or molecular biology with a minimum of 2 years of industrial experience. The successful candidate will have a strong background in RNA biochemistry and molecular biology, with significant experience designing and trouble-shooting quantitative biochemical and biological assays. High-level understanding of ligand-macromolecular binding interactions and enzyme kinetics is essential. The qualified individual should also be proficient in identifying structure activity relationships (SAR) to address lead discovery, potency, selectivity, and efficacy. Preference will be given to candidates with experience overseeing a screening program, including the operation of screening and liquid handling instrumentation. Experience with cell culture techniques and facility maintenance are desirable. The individual must be able to effectively communicate and collaborate with a diverse group of scientists, including biologists, pharmacologists, and chemists. This is an excellent opportunity to be integral part of a diverse team of scientists working to expand the frontier of antibiotics development, bringing new medicines to those critically in need. This position offers the right candidate a highly competitive salary, stock option, and benefit programs reflect the Company's regard for the importance of its employees. Interested applicants should send a cover letter and resume to candidates@biointegrationsearch.com for immediate consideration. Must have 2years or more industry experience. US residents, only.

Enzyme Engineer

As a growing company, we are looking for exceptionally bright and motivated individuals who are eager to showcase their talent, experience and leadership in a team environment. To learn more about the Company, please visit our web site at www.zymeworks.com. Currently, we are seeking an enzyme engineer to take part in in silico enzyme modification projects and actively participate in the development and validation of our in-house molecular simulation software. The successful applicant for this position will start in March of 2007. Required (Applicants will not be considered without the following skills) ? Ph.D. in Molecular Biology or Biochemistry ? Demonstrated experience in rational protein design or directed evolution ? Thorough knowledge and practical experience of structural biology and enzyme mechanisms ? Greater than 2 years of either industrial or academic post-graduate experience in a protein biochemistry-related field ? Ability to communicate in the English language (spoken and written) Further skills (The following skills are an asset to qualified applicants) ? Familiarity with wet-lab techniques and processes for enzyme modification, expression, purification and biochemical characterization ? Experience with homology modeling and docking software ? Experience using molecular modeling and visualization packages (AMBER, CHARMM, VMD, Chimera, etc.) ? Knowledge of the Linux operating system ? Experience in one or more scripting languages (Perl, Tcl, etc.) ? General understanding of the software development process ? Should know about: AAGGAGAACGATCGTGAATGG Duties: ? Perform feasibility studies for proposed protein engineering projects ? Propose and carryout internal projects for software validation ? Write analysis tools in the perl and Tcl/Tk scripting languages ? Closely interact with the software development team to improve and advance the functionality of our in-house modeling/analysis package ? Assist in the selection of commercial software tools to supplement our in-house package ? Participate in the preparation of patents and publications Salary and benefits are commensurate with experience and are highly competitive with industry standards. Due to the high volume of applicants, only candidates selected for an interview will be contacted.

biochemistry

Respected Sir, Sub : Application for the post of LAB TECHNICIAN I have finished my Msc biochemistry and diploma in medical lab technician with one years of experience in munnas cytology and cancer screening at pondicherry. I wish to apply for the said post as my experience meets the requirements and I have attached my resume for your kind persual. I will be eager to get reply to this as soon as possible. Thanking you CURRICULUM VITAE I. MOHAMED ALI D.D.MANSION ROYAPETAH CHENNAI Cell: 9843309654 Ph: 04368 ? 226342 & nbsp; ; aleefy2k@yahoo.com OBJECTIVE: To strive and serve the community. To become an indispensable part of any organization I work for. To work for the growth and development of the organization with full commitment. Loyalty, sincerity and hard work. SKILL SET: Biomolecules Metabolism Clinical Biochemistry Human Physiology Cytology Microbiology Immunology Pharamaceutical Chemistry Biotechnology Genetic Engineering EDUCATION: Master degree in Biochemistry. From E.G.S.P.A.& S. College Nagapattinam, Tamil Nadu , India Affiliated to Bharathidasan University , Trichirappalli, Tamil Nadu , India Aggregate: 68.5% Bachelor Degree in Biochemistry. From T.B.M.L. College , Porayar, Tamil Nadu , India Affiliated to Bharathidasan University , Trichirappalli, Tamil Nadu , India Aggregate: 58.5% Diploma in Medical Labaratory Technician. From E.G.S. Pillay Medical institute. Nagapattinam. (Tamil Nadu) EXPERIENCE DETAILS: 1 year experience at KARAI LABS (X-ray ? ECG attached) Biopsy and Microbiology centre., Munnas cytology clinic and cancer screening. Karaikal-pondicherry COMPUTER LITERACY: � Ms Office � Programming in ?C? OTHERS: � Type writing (English) Passed in Lower. SEMINAR DETAILS: � Paper presentation in Diabetes mellitus state level seminar at Trichy. PROJECT DETAILS: � Title: Screening of Inborn Error in Metabolism PERSONAL DETAILS: Date of Birth : 17-01-1982 Age : 23 Years Father?s Name : Ibrahim Gender : Male Marital Status : Single Nationality : Indian Religion : Islam Languages Known : English, Tamil (Read & Write) Strength : Loyal, self belief and Hard Working DECLARACTION I hereby declare that the information and facts stated above are true and correct to the best of my knowledge and belief. Signature (I. MOHAMED ALI)

business analyst biotechnology

i am a m.sc bioechnologist and have ahand ful of experience of 2and a half years in business development and also done expertise in various techniques. presently working in a ciotech company in new delhi

Chemist - entry level

Are you a recent grad with a science degree in chemistry, biochemistry or biology (or equivalent)? If so, we want to talk to you. About the company: The company makes store brand vitamins, minerals, supplements and over-the-counter drugs for America's top retailers. We currently have multiple openings for entry-level and experienced chemists.

Scientist - Organic Chemistry

Scientist ? Organic Chemist Our client is seeking an organic chemist to work with the current chemistry team to develop processes based on our biocatalysts. Experience in synthetic organic chemistry and specifically in pharmaceutical process development is required. Experience in the use of enzymes in the chemical synthesis would be an asset. Responsibilities include: Design and execution of experiments aimed at optimizing performance of developmental enzymes Participation within a multi-disciplinary team of molecular biologists, biochemists and bioinformatics experts Design and development of scalable processes to target molecules using bio-catalysis. Synthesis of organic substrates Preparation of lab samples for customers by agreed timelines Development of written procedures and specifications for tech transfer to manufacturing partner Qualifications required: � PhD in Organic Chemistry with 2+ years experience or a MS in Organic Chemistry with 5+ years of industrial experience in synthetic organic chemistry and pharmaceutical process development. � Chemical process research and development experience � Critical thinking and attention to detail. � Dedication to safe work practices � Ability to multitask and produce quality results under tight timelines � Ability to work within a multidisciplinary team � Ability to work independently � Persistence and creativity. � Good oral and written communication skills Interested, please submit your resume in MS Word format to: search@scientecsearch.com

Research Computational Chemist

Opportunities in computational chemistry are available with the US Army ERDC Computational Chemistry Team. Cuurent research topics include following competing transformation mechanisms and rates of transformation for nitroaromatic energetic compounds, cyclic and cage cyclic nitramine compounds as well as emerging compounds of Army and DoD interest. The new team member will be expected to 1) Perform computational chemistry and spectroscopic verification; 2) Participate in writing proposals and publications, including peer reviewed journal articles and technical bulletins/reports; 3)Collaborate with scientists on projects pertaining to the Army mission within and outside ERDC. Knowledge of or experience with UV, Vis, FTIR and HPLC spectroscopic techniques, as well as knowledge of or experience with NMR and MS methods are desirable. Recruiting incentives may apply in specific cases. MUST be US citizen.

ANALYTICAL TOXICOLOGY RESEARCH ASSISTANT

I have a Bachelors Degree in Chemistry, and am worked as Reserch assistant in AMRITA INSTITUTE OF MEDICAL SCIENCE TOXICOLAGY LAB and previously worked as a Research chemist in R and D of Avt spices pvt Ltd (N.P.L Vazhakulam)INDIA , since 01-06- 2006The Laboratory is certified by ISO 9001:2000, ISO 14001 and ISO 17025. I have analytical experience in determination of Pesticide Residues, Mycotoxins and Adulterants in SPICES BOARD LAB (GOVT OF INDIA), and I have been using instruments like spectrophotometer (Varian) Gas Chromatographs (Perkin Elmer, Shimadzu, Agilent), HPLCs (Waters, Varian, Thermo Finnigan), AAS (Perkin Elmer), GC MS/MS (Varian) and LC MS/MS (Perkin Elmer / Applied Biosystems) in the course of my work.

Head of the Synthetic Chemistry Center

We are seeking an experienced Synthetic/Medicinal Chemist to build and direct our Chemistry Center. The Chemistry Center is engaging in the design, synthesis and identification of novel organic compounds as promising chemical tools and/or therapeutic candidates using synthetic chemistry approaches. The primary responsibility of this position is in charging of the overall strategy and function of the chemistry group, including setting up the laboratory, recruiting, managing and supervising a team of chemists to meet the demand of internal small molecule discovery efforts. The head of the Center will work closely with a group of experimental biologists and computational chemists to initiate and strengthen small molecule associated biology research programs at NIBS. The successful candidate is expected to report regularly to NIBS directors and communicate with internal and external scientific communities. Independent research programs are also encouraged with the primary responsibility fulfilled. Requirements - PhD in Organic/Medicinal Chemistry with advanced postdoctoral experience preferred - Demonstrated leadership in academic/industry research setting - A proven track record in the design, synthesis and development of small molecule drug candidates, experience in structure-based drug discovery is a plus - Strong publication record and presentation skills Interested applicants should submit a cover letter, a detailed CV and three reference letters to daichunling@nibs.ac.cn

Research Scientist, Analytical Development

Responsible for cGMP /GLP Planning for implementation pertaining to sample analysis and review. Stability of finished product. Validation of analytical methods and impurity profiles for regulatory requirements. Responsible for review and approved standard operating procedures, specifications and standard test procedure. Responsible for calibration of Instruments . Preparation of working standards. Coordination for QA Team Analytical method development by Chromatographic technical like HPLC and UV Spectrophotometry.

Lab Technicians (refinery oil company)

FRESH Msc.(chemistry) (Analytical chemistry)

Sr Executive/Asst Manager Stores

Must be B.Com or suitable/added qualification. Minimum 10 years experience in reputed Pharma Industry with expouse to Excise Liason & Procedures. Knowledge of RM/FM/EM stores & formalities. Material inward/outward records req for Pharma Industry. Knowledge of EOU related formalities will be an additional advantage

job

R&D Q.C

President

SYNTHETIC ORGANIC CHEMIST for a San Diego Big Pharma company. The job description is as follows: This position requires a minimum of a M.S.or B.S. plus 5-8 years experience as a chemist. The candidate must be able to work independently and have excellent written and oral communication skills. Would prefer a candidate with a strong Medicinal Chemistry and Combinatorial Chemistry background as well. - In the high throughput discovery environment, he/she will focus on the synthesis of designed templates for targeted libraries to support therapeutic projects; develop new reaction protocols necessary for the library production; prepare hits from the libraries for further biological evaluation. This position is for a scientist with strong skills and experience in synthetic organic chemistry. The candidate must be competent in all standard organic synthetic and purification techniques such as chromatography, fractional distillation, crystallization and the interpretation of spectra. Experience in parallel synthesis is a plus. He/She is also required to write reaction protocols and research reports, and to present work in a team setting periodically. ----------------------

Analytical Chemist

ICP/MS metals analyst in complex matrix. Production lab in environmental industry needs a chemist with at least 2 years expereince doing analysis. Must be familiar with Perkin Elmer equipment.

Work Abraod

Doctors/ Medical Professionals Experience 3 - 8 years Industry Type Healthcare / Medicine Functional Area Pharma / Biotech / Healthcare / Medical / R&D Keyword Doctors, Healthcare, Laboratory service, Pathology service, Radiology, LPN & LVN, Medical Rep, Medical Officer, Bio/ Pharma, Pharma, Microbiologist, Nephrologist, Neurologist, Nurse, Oncologist, Opthamologist, Orthopaedist, Paramedic, Pathologist, Pe Location Australia, Canada Education UG - B.Sc - Any Specialization;BDS - Dentistry;MBBS - Medicine PG - Post Graduation Not Required

RESEARCH ASSOCIATE

MEDICINAL CHEMISTRY ACTIVITIES.

R&D and QC

synthesis of organic chemistry

trainee chemist

pharmaceutical

Sr. Scientist - Medicinal Chemistry/Organic Synthesis

Job Requirements: -Ph.D. in Synthetic Chemistry or Medicinal Chemistry -Strong background in organic synthesis -Industry experience in medicinal chemistry for drug discovery & development ? 4 years minimum -Creative approaches to problem solving & design of experiments Job Description: -Responsible for conducting scientific research for the discovery of drugs & the development of drug candidates -Identify and validate targets -Develop cutting edge techniques to isolate characterize, purify and produce substances, reagents, assays and tools for use in other research projects. -Plans, designs, implements and analyzes laboratory experimentation to expand knowledge of drug substances or to identify drug substances. -Participates in development of patent applications. -Participates in group meetings. -Publish in scientific journals and present research at conferences when appropriate

Computational Chemistry Contractor (with option to hire)

Term 6+ months with the right to hire Education College graduate, Technical certifications a plus Years Experience: Minimum 4 years experience in Pharmaceutical / Biotech environment Minimum 6 years IT experience Skillset Excellent written and verbal communication skills Experience supporting computational chemistry organization Linux/Unix system administration Experience with the following software applications/packages Schrodinger Suite Tripos Suite Pipeline Pilot Basic Shell scripting FlexLM licensing Windows and Linux integration (SAMBA) Strong problem resolution skills Major Responsibilities Document existing environment and processes Design and implementation of new computational platforms General support for existing computational chemistry platform Lead future projects for computational group Document user requirements Design and implement test plans

Manager- Computational Chemist

Educational Qualification: PhD in a relevant field such as Computational, Physical, or Theoretical Chemistry; Molecular Biophysics; Computational Biology. Background Experience: The candidate will have had post-doctoral experience at minimum at a world-class university or research institution. Core Skills / Competency: Though an in-depth knowledge of the computation of protein-ligand binding free energies, molecular dynamics and/or Monte Carlo simulations of biomolecular systems, application of statistical mechanics to biomolecular systems, free energy perturbation methods, and methods for speeding up evaluation of electrostatic energies is highly desirable, specific knowledge of any of these areas is less critical than exceptional intellectual ability and a demonstrated track record of achievement. Two especially important criteria for these candidates are that they (a) have a strong publication record and (b) are familiar with and interested in primarily computational methods (we do not currently have wet-lab facilities). Detailed Responsibilities: The manager will perform hands-on technical research such as setting up, running and analyzing molecular dynamics simulations on our supercomputers (currently a large general purpose cluster, and in the future, specialized hardware). His/her responsibilities would also include recruiting and training up a new team of computational chemists (mainly fresh top graduates of top universities), ensuring that the team functions effectively, and most importantly communicating and coordinating with the US?based team on a daily basis regarding scientific research. Personal Characteristics: Successful hires will have strong oral and written communications skills, demonstrated good leadership skills, exceptional intellectual ability, and excellent track record of academic and professional performance.

Principle Scientist

MAJOR SKILLS REQUIRED: A variety of application development tools such as C++, C#, Python/Perl data mining technology, strong analytical and scientific skills. Background in computational chemistry, statistics, computer science. Strong background in some set of statistics, image analysis or similar such as pattern recognition, novel database design and data mining or equivalent experience in a scientific discipline. RESPONSIBILITIES REQUIRED: Ensure that best in class tools for hit identification are applied to the HTS data produced by New Leads Biology. Work with biologists, computational chemists, chemists, statisticians and vendors to develop appropriate methodologies and tools for hit assessment and ensure that these tools are applied on a routine basis. Work with New Leads Biologists and Chemists to assemble the data sets and supervise running of the analyses, and report the results for interpretation by the hit teams. Similarly ensure availability of tools for the evaluation of the quality of the HTS data to eliminate erroneous and false positive data by using data mining, visualization and statistical techniques and run analyses as needed. As with the cheminformatics tools ensure that these QC tools are applied routinely and are broadly available. Use experience in running analyses to develop applications to support screen quality and hit assessment. Contribute to the design and development of HTS Tool set, with an emphasis on down stream analysis. Work with Cheminformatics experts to evaluate new tools as appropriate. Develop standard data sets for testing of new tools and products. POSITION: ChemoInformatics/Programer/Dataminer EDUCATION PREFERRED: PhD or strong MS in Biology/Chemistry with strong informatics skills. YEARS OF EXPERIENCE PREFERRED: 2+ years post-PhD, 5+ years post-MS.

Analytical Chemist

A Leading Commertial Testing lab ,looking for an Analytical chemist with GC or GC/MS Experience

none

none.. im a final year student of B.Tech biotecnology.. i dnt have any experience.. but i have hands on experience in my field

none.. im a final year student of B.Tech biotechnology.

Research Associate Chemistry

The department of Medicinal Chemistry is focused on identifying small molecule pharmaceuticals to complement Genentech?s Oncology franchise. The Computational Chemistry group (within Medicinal Chemistry) applies computational methods to facilitate the rapid advancement of our small molecule programs, including structure-function data analysis, receptor-based and/or ligand-based design and screening library compound selection. The group also develops tools to facilitate access to our small molecule corporate database. Responsibilities: The successful candidate will be well versed in aspects of structure-based drug design and / or ligand-based design approaches. Responsibilities will include: selection or design of compounds for HTS libraries; rapid analysis of primary HTS data and identification of compounds for additional investigation; structure-based lead optimization; correlation of ligand structure with function or physicochemical properties (potentially involving multivariate data analysis); generation and maintenance of 3D conformational data for commercially available compounds to be used for pharmacophore mining. The candidate will work in close collaboration with research chemists to develop and use predictive models of the structure-activity relationships, hence good communication skills (written and oral) are essential. Requirements A BS/MS degree is required along with a minimum of 4 years computational chemistry experience. Knowledge of organic chemistry and the use of structure-based and cheminformatics approaches to drug discovery is highly desirable. Experience with medicinal chemistry software tools (Schrodinger, Accelrys, SciTegic Pipeline Pilot, Spotfire, ISIS host/base, Daylight), is advantageous. Additionally, a proven ability to work in close conjunction with other research scientists and programmers is expected.

Chemistry Lead/Manager - Process Chemistry

Chemistry Lead (Base in Singapore) The incumbent is responsible for providing scientific leadership and management of the Chemistry Department in support of Client?s development of highly efficient processes to pharmaceuticals. Job Responsibilities Key Responsibilities include but are not limited to: Providing scientific leadership and management of Chemistry Group, which works as part of larger multi-disciplinary Project teams. Additional functions include coordination of efforts with Operations and external CROs' to meet Project objectives and timelines. Leading growth of Chemistry team through recruitment of scientific staff. Participating in design and execution of efficient routes to chemical targets, optimization of process steps Participating in design of experiments aimed at optimizing performance of developmental enzymes. Managing internal synthesis projects as well as synthesis projects contracted to external parties. Managing departmental resources and budgets to meet project timelines. Establishing departmental organizational structure, supervisory relationships, and operating policies. Performing range of supervisory activities including review of salaries, schedules, and performance. Mentoring departmental staff and supporting development of career paths and professional growth. Requirements/Qualifications PhD in Synthetic Organic Chemistry or Biocatalysis, or a related field, plus minimum of 5 years of pharmaceutical chemical development or process development experience. Strong working knowledge and practical experience in synthetic organic chemistry and pharmaceutical process research and development, and methods of scientific investigation. Able to recruit and retain highly qualified scientists for department. Able to perform effectively and execute independently a wide variety of assignments of both a scientific and business nature. Required to have the ability to manage multiple groups, effectively coordinating their efforts to advance a product or process of major significance to the company. Expected to advance new ideas or initiate the introduction of new technology to advance Project goals. Expected to make pivotal contributions to process research and development and technology development. Strong problem-solving skills and track record of successful management and leadership of projects and/or teams within an interdisciplinary environment. Has made fundamental contributions to the development and implementation of routes to API's, process improvements or scientific processes of major significance, including the introduction of novel methodology. Superior verbal and written communication skills, including presentations, negotiations, and scientific correspondence. Writing should require little or no external editing. Excellent observational, organizational, data management and documentation skills. Interested applicants, please submit your resume in MS Word format to: search@scientecsearch.com

R&D Director of Biochemical Experiements ? ENG205

EXECUTIVE OFFICE SERVICES Human Resources Consultants POSITION: R&D Director of Biochemical Experiements ? ENG205 EMPLOYER: A well-funded start-up organization that has a patented process for the conversion of sunlight to petrochemical products. LOCATION: Florida CAREER OPPORTUNITY: R & D - Director of Biochemical Seeking a Sr. Engineering R&D Director to work within a well-funded start-up organization who has a patented process for the conversion of sunlight to petrochemical products. The ideal individual will have significant experimental design and program management experience and preferably a background in algae cultivation. This position will be instrumental in developing solutions to maximize algae growth rates and algae oil yields under a wide range of environmental conditions and will report directly to the CTO . In addition, this individual will be responsible for building and managing a group of high-caliber scientists and engineers. - Extensive experience developing, planning, and implementing various experiments and statistical testing - At least some knowledge of aquaculture and algae - Proven people & leadership skills. - Provide design input to the process engineers based upon test results and financial impacts. QUALIFICATIONS: Primary Skills Required: Biological testing, experiment design, statistics, project management Secondary Skills: Algae cultivation MS required in Chemical Engineering or Biochemistry or related field, PhD preferred Multi-disciplinary technical and engineering experience, with strong knowledge of process engineering and biological (including sterile) experimental protocols Minimum of 10 years laboratory and experiment and field design experience Capable of working in a highly entrepreneurial, unstructured, fast paced environment. SALARY: $90,000 ? 120,000 & Bonue & Equity Send resumes email to: Executive Office Services. CAREERS@EXESERVICE.BIZ Phone: (510) 830-9721 Executive Office Services is an Executive Recruiting Consultant Enterprise dedicated to helping professionals in furthering their career goals. Success is attributed to the personalized service, with the goal of bringing together qualified business professional with quality companies. We have a variety of opportunities available. If you are looking for an Executive Human Resources Consultant please feel free to contact:. Executive Office Services. CAREERS@EXESERVICE.BIZ Phone: (510) 830-9721 Due to the high volume of resumes received daily from candidates responding to positions nationwide, you may not be contacted immediately. If you are not contacted within 7 business days, we may not have a position meeting your expertise or the position you applied for has been staffed. Should that be the case, we will place your resume in our keyword searchable database. In the event an opportunity becomes available which requires a professional with your expertise, a representative will contact you, regarding your availability and interest in the position.

Working in Research And development

I am working in four year in R&D .I have good knowledge about Chemistry . RESUME MR. HONRAO IRGONDA APPASO (M.Sc Polymer Chemistry) OFFICER R&D, MNC irgondahonrao@yahoo.com ? OBJECTIVE: Hard Work is my way towards success. To excel in career considering all the assignment as a Challenge environment where there is scope for upgrading my skill and Knowledge and where I can take active part in the growth of the organization ? WORK EXPERIENCE ? CURRENT EXPERIENCE ORGANIZATION: UNITED PHOSPHOROUS LTD (THANE, MUMBAI) DURATION: 15th Sept 2004 Till Date DESIGNATION: OFFICER R&D DEPARTMENT: SYNTHESIS PRODUCT: AGROCHEMICAL RESPONSIBILITY: 1) Synthesis the product 2) Technology Transfer R & D to Pilot Plant 3) Preparation of Impurity 4) Preparation of Raw Material 5) Handling of Homogeneus &hetrogeneus catalysis 6)De hydrogenation Allipatic Compounds. 7) Azotropic distillation. 8)Preperation of Homogeneous Chiral Catalysis. 9) Process development for continues reaction. 10)Oxidation reaction reaction. 11)Reduction . 12)Bromination . 13)Condensation reaction. 14)Handling fix bed reactor.for Dehydrogenation. 15)Route selection for reaction Suitable for low cost. 16) Carry out Literature search. 17)Handling high pressure reactor. 18)Synthesis and optimization of new chemical entities. 19)Responsible for research activity in lab. 20)Research and process development activity for new molecules. 21)Process Scale up and pilot plant studies. 22)Self Starter. 23)Technical leader in their discipline. 24) Working in a team invironment. 25)Ability to travael local and internationally. WORK EXPERT: 1) Hydrogenation of Imine by using Chiral Catalysis. 2) Chlorination Aromatic and Alliphatic compounds. 3)Work independently . Training Attend: 1)Safty Training . 2)Aspen tech Softwar Training attend. 3)GC and HPLC training . 4) Security of R&D information . Total number of projects handled: 15 (Till Date) ? PREVIOUS EXPERIENCE ? ORGANIZATION: ELKAY SILICON POLYMER. PVT. LTD (PUNE) DURATION: 20 May 2003 To 1 March 2004 DESIGNATION: TRAINEE (Quality Control Chemist) DEPARTMENT: QUALITY CONTROL RESPONSIBILITY: 1) To determine Viscosity of polymer by using Brookfield Viscometer 2) To determine Volatile Content &Solid Content 3) To determine refractive index of polymer 4) To determine Clarity of polymer 5) To determine Acid Value PRODUCT: SILICON OIL OTHER INSTRUMENTS HANDLED IN THE COMPANY 1) Infra-red (IR) Spectroscopy 2) Differential Scanning Calorimeter 3) Thermo gravimetric Analysis 4) Polymer Characterization 5) UV Spectroscopy 6) Premier Color scan(Color matching) 7) Gas Chromatography 8) Karl-Fisher ORGANIZATION: GRATEX INDUSTRIES LIMITED DESIGNATION PRODUCTION-SUPERVISOR DURATION 3 Months RESPONSIBILITY 1) Quality Control 2) Color Matching 3) Work Management PRODUCT WALL PAPER ? EDUCATIONAL QUALIFICATION Master of Science in Polymer Chemistry in 2003 From Shivaji University, Kolhapur Grade-First Class With 63% Bachelor of Science in Chemistry in 2000 From Willingdon College, Sangli Shivaji University ,Kolhapur Grade-First Class 60% ? COMPUTER KNOWLEDGE: Basic Computer Knowledge ? PERSONAL INFORMATION NAME Honrao Irgonda Appaso BIRTH DATE 07/06/1979 PRESENT ADDRESS Laxmi park Phase-1, C-2 Room No.404 , Pada no-2 Lokmanyanagar . THANE(W) PERMANENT ADDRESS A/P Chabukswar ?wadi (salagre) Tal- Miraj Dist ?Sangli E-MAIL ADDRESS irgondahonrao@yahoo.com SEX Male MARITAL STATUS Single NATIONALITY INDIAN PHONE NUMBER 09819651766 DATE SIGNATURE

Junier Chemist

RESUME MR. HONRAO IRGONDA APPASO (M.Sc Polymer Chemistry) OFFICER R&D, MNC irgondahonrao@yahoo.com ? OBJECTIVE: Hard Work is my way towards success. To excel in career considering all the assignment as a Challenge environment where there is scope for upgrading my skill and Knowledge and where I can take active part in the growth of the organization ? WORK EXPERIENCE ? CURRENT EXPERIENCE ORGANIZATION: UNITED PHOSPHOROUS LTD (THANE, MUMBAI) DURATION: 15th Sept 2004 Till Date DESIGNATION: OFFICER R&D DEPARTMENT: SYNTHESIS PRODUCT: AGROCHEMICAL RESPONSIBILITY: 1) Synthesis the product 2) Technology Transfer R & D to Pilot Plant 3) Preparation of Impurity 4) Preparation of Raw Material 5) Handling of Homogeneus &hetrogeneus catalysis 6)De hydrogenation Allipatic Compounds. 7) Azotropic distillation. 8)Preperation of Homogeneous Chiral Catalysis. 9) Process development for continues reaction. 10)Oxidation reaction reaction. 11)Reduction . 12)Bromination . 13)Condensation reaction. 14)Handling fix bed reactor.for Dehydrogenation. 15)Route selection for reaction Suitable for low cost. 16) Carry out Literature search. 17)Handling high pressure reactor. 18)Synthesis and optimization of new chemical entities. 19)Responsible for research activity in lab. 20)Research and process development activity for new molecules. 21)Process Scale up and pilot plant studies. 22)Self Starter. 23)Technical leader in their discipline. 24) Working in a team invironment. 25)Ability to travael local and internationally. WORK EXPERT: 1) Hydrogenation of Imine by using Chiral Catalysis. 2) Chlorination Aromatic and Alliphatic compounds. 3)Work independently . Training Attend: 1)Safty Training . 2)Aspen tech Softwar Training attend. 3)GC and HPLC training . 4) Security of R&D information . Total number of projects handled: 15 (Till Date) ? PREVIOUS EXPERIENCE ? ORGANIZATION: ELKAY SILICON POLYMER. PVT. LTD (PUNE) DURATION: 20 May 2003 To 1 March 2004 DESIGNATION: TRAINEE (Quality Control Chemist) DEPARTMENT: QUALITY CONTROL RESPONSIBILITY: 1) To determine Viscosity of polymer by using Brookfield Viscometer 2) To determine Volatile Content &Solid Content 3) To determine refractive index of polymer 4) To determine Clarity of polymer 5) To determine Acid Value PRODUCT: SILICON OIL OTHER INSTRUMENTS HANDLED IN THE COMPANY 1) Infra-red (IR) Spectroscopy 2) Differential Scanning Calorimeter 3) Thermo gravimetric Analysis 4) Polymer Characterization 5) UV Spectroscopy 6) Premier Color scan(Color matching) 7) Gas Chromatography 8) Karl-Fisher ORGANIZATION: GRATEX INDUSTRIES LIMITED DESIGNATION PRODUCTION-SUPERVISOR DURATION 3 Months RESPONSIBILITY 1) Quality Control 2) Color Matching 3) Work Management PRODUCT WALL PAPER ? EDUCATIONAL QUALIFICATION Master of Science in Polymer Chemistry in 2003 From Shivaji University, Kolhapur Grade-First Class With 63% Bachelor of Science in Chemistry in 2000 From Willingdon College, Sangli Shivaji University ,Kolhapur Grade-First Class 60% ? COMPUTER KNOWLEDGE: Basic Computer Knowledge ? PERSONAL INFORMATION NAME Honrao Irgonda Appaso BIRTH DATE 07/06/1979 PRESENT ADDRESS Laxmi park Phase-1, C-2 Room No.404 , Pada no-2 Lokmanyanagar . THANE(W) PERMANENT ADDRESS A/P Chabukswar ?wadi (salagre) Tal- Miraj Dist ?Sangli E-MAIL ADDRESS irgondahonrao@yahoo.com SEX Male MARITAL STATUS Single NATIONALITY INDIAN PHONE NUMBER 09819651766 DATE SIGNATURE

Researcg R&D

Senior Pharmacologist

Designation : Senior Pharmacologist Grade : Managerial Cadre Work Place : Initially will be based at Pune. Should be willing to relocate to Hyd after 6-8 months. Job Description : In vivo Pharmacology Team leaders for setting up of mechanistic and disease specific in vivo animal models in rodents and large animals. Hands on experience of developing appropriate animal models for drug discovery program or for safety pharmacology studies for NCEs, interpretation of data and familiarity with ethical consideration while using animals for research would be essential. Qualification: Ph.D. or Masters in Pharmacology/ veterinary sciences or related sciences Experience : more than 5 years of relevant experience in pharmaceutical industries. Salary Range : As per the industry standards.

biochemist

Application Specialist in Diagnostic industry

Medicinal chemist

computational chemist

Computational Modelling profiles - PH D's with experience on working on Tripos and accelyrs s/w.As also PhD's with computational chemistry experience(3 to 5 years)

Sr Research Chemists - Petrochemical

I am an Executive Recruiter that specializes in the Petrochemical, Pipeline, and the Utility industries. My specialty is sourcing experienced high potential talent. I have worked searches for most all the major oil & gas companies and their many business units, including their refineries, chemical plants, terminals, crude pipelines, and natural gas pipelines, also Technology Center Consulting divisions, asset management, financial, and supply chain management. I am searching for 8 Sr. Research Chemists for a TX location with petrochemical any of the following; Scope: Flow Assurance ? Inhibitors for deepwater and gas pipeline. Laboratory preparation of Product, Formulations, Testing, Statistical Processing &and Customer Interaction. Experience sought: 0-5 years Education: PhD in Organic, Polymer or Organic Synthesis Scope: Flow Assurance - Fouling ? Emulsion Breaking, Water Clarification and Fouling for Heavy Oil. Laboratory preparation of Product, Formulations, Testing, Statistical Processing and Customer Interaction. Experience sought 0-5 years Education: PhD in Organic, Polymer or Organic Synthesis Scope: Oilfield Chemicals ? Anti Agglomerant Chemistries ? deepwater. Laboratory preparation of Product, Formulations, Testing, Statistical Processing & Customer Interaction. Experience: 0-5 years Education: PhD in Organic or Surfactant Science with Organic Synthesis Scope Oilfield Chemicals ? Electrochemistry ? Oil Production Corrosion Prevention (Corrosion Inhibitors) Experience Sought: 0-5 years (Not Solid State i.e. Batteries) Education: PhD in Electrochemistry, Surfactant Science or Colloid or Interface Science. Scope ? Oilfield Chemicals ? Surfactant ? Production Maximization ? Enhance Oil Production through Increasing Water Injectivity ? Enhance Gas Production through Foamers and Friction Reducers. Experience Sought: 0-5 years Education: PhD in Surfactant Science or Colloid or Interface Science. Scope: Determine Problems. Diagnostic, Testing Methods and New Product Development Experience sought: 3-5years Education : PhD ? Organic or Organic Synthesis Note Education: No Physical Chemistry or Inorganic PhD?s will be considered. All Candidates must be eligible to work in the US, no sponsorships.

Computational Cheminformatics

Position 1) Computational Cheminformatics position. Candidate will participate in the research projects involving pharmacoinformatics virtual screening and computer-aided drug design. Candidates who have background/training and experience in computational chemistry, cheminformatics, bioinformatics, or computer molecular modeling are encouraged to apply. Candidate with computer programming or database construction is a plus. Salary will be commensurate with experience. Position 2) Database Programming Position for building molecular information database repository system. The candidate should have at least 3 yrs working experience with database design and development using SQL or Oracle, and ASP, C++, VB, or Java programming. Experience in bioinformatics or cheminformatics is a plus. The candidate will also have an opportunity to learn computer-aided drug design and virtual drug screening techniques. Salary is negotiable. Please email CV and three names of references to xix15@pitt.edu : Prof. Xiang-Qun (Sean) Xie, Drug Discovery Institute/Dept. of Pharmaceutical Sciences, School of Pharmacy, University of Pittsburgh, Pittsburgh, PA 15260, 412-383-5276(Phone) 412-383-5298 (Fax)

Core Chemistry Software Development

CambridgeSoft Corporation (www.cambridgesoft.com) is the leading supplier of Internet browser and webserver based life science desktop software, enterprise solutions, chemical databases and consulting services to the biotechnology, pharmaceutical and chemical industries. COMTEL Software Pvt. Ltd. is a Business Partner of CambridgeSoft. Candidates will be appointed through COMTEL at Mumbai to work on the CambridgeSoft Product development. CambridgeSoft is on the look out for experienced C++ developers having qualified and/or experienced in Chemitsry / Life Sciences related field.

Chemist - online review

Chemist with analytical chemistry background needed to review data online. Candidates will be trained to review Acrobat files of data, training can be onsite or by teleconference. Traning period will be 2 or more weeks. Analyst will be required to review data according to Standard Operating procedures. A background in chromatography is essential. Spectral data experience is also essential.

chemist assistant

doing research, or a assistant in a lab

qc officer

yetyrttyrtrtr

R&D & QC officer

handle any instruments

Business Development

Applying for a suitable job

Respected sir, I, amutha rexlin punitha i would like to apply for job in ur renowned company. I have completed MSc in Bioinformatics with (75%) from Vivekanandha college of arts and science Institute,Namakkal.I have done project in Comparative Modeling method. I hereby enclose my resume for your further verification. I would be pleased to render my best efforts for your organization if there is an opportunity provided. Thanking you A.Amutha Rexlin Punitha Msc Bioinformatics, D/oMr.K.Antony, Antony Illam, Chithenthoppu, Kandanvilai Kanyakumari dist.tamil nadu mobile:9865752197

Bio-analytical chemist/

- PH D's with experience in Bio analytical areas, or with Parallel Synthesis experience

Lead Process Engineer

Essential Duties and Responsibilities ? Lead the overall process development activities from bench scale through the pilot plant to commercialization for the production of high value chemicals using Virent?s BioForming technology platform. ? Work with project collaborators and lead all process engineering activities associated with a recently awarded $2 mm USDA grant to produce propylene glycol from biodiesel derived glycerol. ? Use chemical engineering skills to synthesize new process designs for chemical production utilizing Virent?s novel catalyst technology. This includes developing methods for the purification of biomass-derived liquid feedstocks and the purification of the resulting end-products. ? Develop process flow diagrams, heat & material balances, piping & instrument drawings, and economic estimates of chemical processes from initial concept to final design. ? Work with R&D and Business Development to identify and prioritize chemical products targeted for commercialization. ? Collaborate with R&D to improve and optimize reactor designs for chemical production. ? Develop heat and mass transport models of reactors and other chemical processing equipment using accepted engineering practices. ? Provide internal and external project updates as required. ? Coordinate work of internal and external resources and act as the engineering interface with customers and partners. ? Execute departmental administrative tasks as necessary, such as participating in the strategic planning process; budgeting for the department and its assigned projects; and resource planning. Minimum Education and Experience Requirements ? EDUCATION: BS in Chemical Engineering. MS is preferred. ? EXPERIENCE: 7 years minimum desired. 10+ years preferred. Knowledge, Skills, and Abilities necessary to perform essential functions ? Experience in processing of biomass-derived feedstocks. ? Ability to conceptualize, develop, and screen new chemical process designs using sound engineering and economic principles. ? Experience with all phases of process development from initial concept to lab prototypes to pilot plants to commercial scale plants. ? Experience with heterogeneous catalysis systems and reactor designs for chemical production. ? Knowledge in the design and operation of chemical separations, including distillation. ? Advanced skills in steady state and dynamic simulation using Aspen Plus are required. ? Process design skills including equipment sizing and specification, heat and material balances, PFD and P&ID development, relief load calculations, and instrument specifications are required. ? Experience with process controls and/or Process Hazard Analysis (especially HAZOP) a plus ? Able to accept responsibility and follow through on multiple tasks simultaneously to completion ? Able to function efficiently in a team environment ? Able to adopt an applications-oriented, hands-on focus ? Strong oral and written communication skills

R&D

synthetic organic chemistry

chemist process controller quality controller

chemist procees controller quality controller

synthetic organic chemistry

synthesis of organic chemistry ? Handling reactions from mg scale to kg scale. ? Well versed with most modern analytical instrumentation and expertise in characterizing organic molecules using IR, NMR, MASS and LCMS. ? Experience in documentation of the developed process. ? Well acquainted with purification techniques (Recrystallisation and column chromatography) ? Experience in the operation of Par hydrogenator and various distillations. ? Well experienced in handling of hygroscopic, air sensitive reagents and reactions. ? Capable of collaborative and independent work. ? Well versed in carrying out the work on literature survey.

Lab Analyst/Technician

Data Mining Software Engineer

Position Description: Data Mining Software Engineer Data Mining (Machine Learning) experience required, specifically, in the area of Collaborative Filtering, Associations, a priori, Sequential Patterns, Probability Theory. Requirements: M.S./PhD in Computer Science, Statistics, Applied Mathematics, Physical Sciences or a related field, or equivalent experience is preferred. Data Mining, Machine Learning technologies, modeling, tuning, testing and interfaces expertise Experience working on systems used to provide customer relationship management or targeting functions Familiarity and experience in different phases of software development life cycle. Structured thinker, effective communicator, team player with ability to work with dynamic teams Good understanding of algorithms, data structures, performance optimization techniques, and object-oriented programming Good programming skills in C++, PERL and Java (J2EE) in a UNIX/Linux environment Strong skills in algorithms and working with large volumes of data. Database access methodologies experience Integration Standards (XML-centric) experience Ideal candidate will have strong skills in statistical analysis of large quantities of scientific measurement data, deep knowledge of relevant metrics for real-time systems, and a good understanding of data mining techniques. Experience with medical data is a plus. Job Functions: Architect and design different applications that are standards-based and which integrate into the offerings of our company Determine which data mining technology combinations to use to solve specific business problems. Assume ownership of data mining modeling strategy, delivery and success Develop extensible, scalable, reliable software Interact with other teams to define interfaces and understand dependencies Write detailed technical documents Understand and affect the product direction

Process Development Scientist - Protein Purification

Urgent requirement for one of our top clients located in ?Redwood City, CA?. Please contact me at your earliest convenience, along with job No. PDS_110207 to anitha.maturi@makrotech.com Description: The position will require hands-on work developing downstream processes, tech transfer of processes to CMOs and on-site interactions and management of CMOs to facilitate scale-up and clinical/commercial production. The incumbent will be responsible for developing, scaling up, & improving downstream processes in collaboration with external parties and the internally with the Protein Analysis group. The position requires the ability to develop and optimize downstream processes in accordance with regulatory requirements and the company?s timelines for Phase III/commercialization. The individual will also be responsible for identification and implementation of improved technologies for R&D and commercial manufacture to enhance product quality, manufacturing cost efficiencies & regulatory compliance. The position is likely to require the management and training of junior staff. Requirements: Ph.D in Biochemistry or Biochemical Engineering with emphasis on Protein Purification and 5+ years of experience; or MS in Biochemistry or Biochemical Engineering with emphasis on Protein Purification and 10 plus years of relevant industrial experience. Experience in optimization and scale ?up of protein refolding from E. coli is a plus. Prior experience with various PEGylation methods at small and large scale is preferred. Contact: The most effective way of communication is via email please forward us your updated WORD FORMAT resume (Address, Contact number and email is must) to *** anitha.maturi@makrotech.com *** Please mention your best hourly rate, availability and visa status. Any questions, do feel free to email us.

Process Development Scientist - Protein Purification

MEDICAL REPRESENTATIVE

MEETING DOCTORS & RETAILERS, DETAILING MEDICINES, MEETING MONTHLY TARGETS, ETC.

Office Seceretary

Secereterial work at office

Lab technician in manufacturing unit

Job releated for the manufacturing of pharamaceutical product

Regulatory Affairs Consultant

Urgent requirement for one of our top clients located in ?Northboro, MA ?. Please contact me at your earliest convenience, along with job No. REGAC_102507 to anitha.maturi@makrotech.com Description: The main responsibility of this position is to prepare and submit regulatory filings and to gain additional expertise about the different regulatory strategies available to clients with medical devices. Consultants in this position have experience in regulatory affairs and have work experience with a medical device company or as a consultant to medical devices companies. Specific Duties: 1. Be responsible for collecting data and preparing submissions to FDA, including 501k?s, HDE?s, IDE?s and PMA?s. 2. Be responsible for collection data and Preparing submissions to international regulatory agencies. 3. Remain current with FDA and international medical device regulations. 4. Participate in client regulatory strategy sessions and help to develop regulatory strategies for clients. 5. Participate in regulatory and quality system audit. 6. Become current in ISO 13485 QSR requirements. REQUIREMENTS: B.A./B.S. preferably in a science related/health field. Two to five years work experience in regulatory affairs with a medical device company or CRO. Contact: The most effective way of communication is via email please forward us your updated WORD FORMAT resume (Address, Contact number and email is must) to *** anitha.maturi@makrotech.com *** Please mention your best hourly rate, availability and visa status. Any questions, do feel free to email us.

biochemitry

R&D,QC,LAB TECHNICIAN

BeyondTekIT is looking for Title: Systems Analyst ? Services Portfolio Management Location: Cambridge, MA Duration: permanent Salary: DOE My client offers excellent benefits and a wonderful relocation package as well. Please see below the job description for this position. In this position, you will lead Information Systems ITIL/ITSM based service portfolio management function, which drives our adoption of ITIL/ITSM based best practice operational processes across IS and manages our portfolio of applications (services). Responsibilities: The successful candidate will fulfill the lead role in the newly created area of Service Portfolio Management. Service Portfolio Management is chartered with the overall management and oversight of our adoption and adherence to ITIL/ISM best practice operational processes and the maintenance of our configuration management database (CMDB) and Service Catalog. This position is responsible for the ITIL defined roles of enterprise configuration management, enterprise change management, and enterprise release management. Other ITIL/ITSM oversight roles may also fall under this position. This individual will be responsible for advising senior management, functional teams, projects teams and other groups on the design and adoption of ITIL/ITSM practices. The individual will serve as an ITIL/ITSM subject matter expert and provide guidance on processes and practices to further IS adoption of ITIL to achieve operational excellence. This role will manage multiple simultaneous validation, revalidation, and change control activities through contract staff. Requirements: Qualified applicants will have a Bachelor's Degree in Computer Science, Engineering, or basic science At least 5 years of experience around ITIL/ITSM practices, ideally in the healthcare or pharmaceutical industry. The ideal candidate will be ITIL/ITSM certified at the practitioner level, have proven experience leading ITIL/ITSM design and adoption efforts Performing key ITIL process roles in a steady-state ITIL based IS environment, Managing of outsourced and contract staff supporting requirements development, qualification, testing, and release activities is essential, At least 3 years of project management experience is required and PMI certification a plus, Proven team leadership skills and an ability to generate buy-in and project alignment, process design and reengineering, Knowledge of cGMP's and regulatory compliance issues. Strong written and verbal communication skills are essential. PLEASE COMPLETE THE FOLLOWING SKILLS-MATRIX AND SEND BACK WITH YOUR UPDATED RESUME. THANKS! Full Name: Degree Major: Total IT Experience: Total ITIL Experience: Total ITSM Experience: Total Healthcare/Pharmaceutical Experience: Total Project Management Experience: Do you have ITIL/ITSM certification? Do you have a PMI certification? Expected Salary: Previous Salary: Day Phone #: Evening Phone #: Cell Phone #: Availability: Current City, State: Regards, Prem BeyondTekIT Tel: 714-594-5023 Fax:714-364-9705 prem@beyondtekit.com www.beyondtekit.com

protein modeling & drug designing

Iam in interested in bioinformatics job, as i learnt protein modeling and drug designing i want a job in this area,iam ready to work as a project assistant.

Computational Chemist

We are looking for a bright, talented post graduate or a fresh doctoral candidate. The ideal candidate should have sound knowledge of computational chemistry and some experience in the application of computational techniques such as QSAR and pharmacophore design and docking. Candidates who have a knowledge of protein structure will be preferred. We are a drug discovery company with exciting collaborations and vibrant internal programs. Successful candidates will work closely with medicinal chemists and suggest potential hit/lead molecules.

Senior Engineer ? data modeling; schema / ontology mapping

This Engineer will be responsible for programming data model and import curation functions required for creating coherent datasets from multiple data sources. Specifically, this person is responsible for assisting with design and implementation of user-facing functions for structuring data during import, synchronization, and transformation processes. This Engineer must have good interpersonal skills and must be able to work with senior management and other engineers to assure timely, validated product development. This person must have extensive experience with object-oriented programming and with data integration in distributed computing environments. The right candidate is conversant with new ideas, methods, and novel approaches among software engineers and bioinformatics thought leaders. Required Skills and Experience Solid background in C++ design and programming, STL, complexity notation VS 2003 managed C++ and C# Familiarity with informatics software - enterprise data access, management, integration of structured and unstructured data including image-based and relational data, data mining and exchange Relevant education with references to 5+ years of experience in areas described below, developing user-facing software products ETL, database architecture, data import / curation, data joins, cross-database joins Ontology building / merging, thesauri, schema building / merging / management SGML/XML, RDF/OWL, standards and ontologies, XDR/CORBA, SOAP/.NET, and related distributed, object-oriented programming and computing methods

workin as a project on Potassium bio Sensors

Quality assurance manager

To manage all documentation and inspection requirements of US FDA inspection for APIs

process development manager

To manage the implementation of manufacture of drug synthesis from R&D to plant. Must be familiar with working with US FDA approved units.

Research Associate

Structure based drug design for a leading Pharma company in Bangalore. Role would involve you to be actively involved in molecular based drug design

bioinformatician(Drug discovery)

Structure based drug design Rational drug design protein modeling

bioinfomatician

Drug designing / protein modelling

Software Developer

. As an E-Notebook Configuration Specialist, you will configure E-Notebook to an assortment of different setups.To produce and manage material for a variety of scientific disciplines. Skills and Competencies Strong Experience with Form Design software packages (MS Access, Filemaker Pro, programming languages such as Visual Basic, C++, etc.) Preferred experience with SQL (Oracle or SQLServer) Understanding of one or more of the following scientific workflows: Molecular Biology Screening Agricultural Science Food Science Analytical Chemistry Process Chemistry Combinatorial Chemistry Drug Development Quality Assurance Laboratories 2-4 years VB programming experience. Experience with ActiveX / COM objects. XML and SOAP Experience. Strong writing, communication, organization, and computer skills require

Chemical Data Analyst

Company Description: Chemical Database/Software Company, located in Malvern, PA, USA, providing plant, market, process, cost and properties data to the CPI for 26 years. Job Title: Chemical Data Information Analyst Job Description: 1) gather specific plant, market, process information from Internet, publications, patents, conferences and export/import data; 2) analyze the raw data in Excel and import to ChemPlan system; 3) demonstrate the system to potential clients. Requirements: this position is best suited to a self-motivated, team-oriented and organized person; strong analytical skills are required for accurately interpreting the market and process data; chemists and chemical engineers are preferred; minimum a BS degree is required; fluency in English is a must; chemistry or biochemistry degree is preferred.

We are currently seeking POstdoctoral fellow in computational chemistry to join our theoretical chemistry team. This position requires the use of computational approaches in molecular design and bioactivity. Experience in AMBER 5 or 8 or Discover is a requirement.

R&D Chemist

M.Sc or B.Sc Organic Chemistry with research and development experience. Good academic background. Good English writing skills.

Computational biologist

I am a chemistry graduate with 9 years R & D expereience in chemical industry. Now Iam doing M.sc., Bio informatics through distance education.

biochemist,q.control

lab technologist,biochemist,quality control in medical supplies,assist the HR manager in developing human resources policies and procedures,plans ,organizes, controls and directs operation of the department.participated in pruviding advice and assistance when conducting staff performance evaluations

Business Development Directror DMPK/Bioanalytical

Director will secure and retain DMPK and Bioanalytical Business for my client through professional, consultative, proactive sales activities directed at decision-makers and decision influencers at existing and new clinical sponsors. Director will position company as a primary or preferred provider for all work to be outsourced. Director will act as a liaison between sponsors and company on all business development activities and requirements. This position is home-based in Southern California (San Diego Area) and will have responsibility for existing and prospective Pharma/Biotech Clients for Lower California and Select Southwestern States. Director will obtain firm project/task commitments that will meet or exceed authorization targets that will be established annually by the corporation. The incumbent will also be responsible for generating Request for Proposals (RFP?s) from these business segments; Bioanalytical NCE, ADME/PK, Immunogenicity/Biomarkers, Whole Body Radiography and Molecular Biology. The Director will also be expected to service new/existing clients, driving sales to closure working in conjunction with Operations staff, relationship-building at Senior/Decision-maker level across key accounts, Work with Operations to direct and coordinate prospective client visits including pre-visit strategy, meetings and agenda. The Director will also be expected to develop and maintain client relationships and profiles and represent the company at local, national and international meetings pertinent to BA Business Development. The Director will also be responsible for Account Planning, Forecasting and Execution This position requires a minimum of a Bachelors degree in a science or business related discipline or an equivalent combination of education and experience that provides the knowledge, skills, and abilities to perform the job. Individuals with a MS or PhD in Life Sciences preferred. A minimum of five years in a CRO or pharmaceutical sales with a concentration in Bioanalytical services and/or DMPK. Individuals with specific knowledge/contacts within the Bioanalytical Industry are ideal. A strong knowledge of Generics Drug Development/Approval is essential. The Director?s primary responsibilities will include signing new business proposals at or above corporately assigned targets, establishing and executing a comprehensive sales plan for each target account, and communicating all account activity to VP Commercial Operations and/or appropriate individuals within the company. Other responsibilities will include planning and coordinating all client sales activities, reporting any client dissatisfaction, and respond immediately respond to all requests by client or company management, and preparing weekly and monthly priorities, plan and activities reports. Other relevant duties not include in the above description may be required. This position is a home based position and should be located in the San Diego area. This position does require extensive travel at times up to 70% in order to meet customer needs. My client offers a competitive package of salary, variable bonus and stock and an automobile allowance as well as excellent health and dental plan. Interested applicants please forward CV to troy.roessler@bioscouts.com Troy Roessler Senior Search Consultant 117 Bernal Road Suite 70-115 San Jose, CA 95119 (408) 981-6626

chemist

i am offering job following divison 1.synthetic organic chemistry. 2.analytical chemistry

Senior Formulations Scientist

Position: Senior Scientist Reports to Director of Research Recruit will be responsible for the research and development of commercializable drug formulations for topical application to skin. Recruit will work closely with skin permeation measurement, research engineering, and computational functions in fqubed, and with the product development and manufacturing functions h. Position Offers Opportunities to: Play a leading role in the development of new topical drug products Apply leading science & technology to important health and skin health problems Achieve substantial science and technology impact Work for a small, high science, high technology company that is based in San Diego Position Offers Competitive Compensation Package: Requirements: PhD in Materials Science, Chemical Engineering, Chemistry, Biomaterials, Biology or other relevant discipline Experience and proven expertise in development of topical drug formulations particularly emulsions and gels or comparable products Capacity for self-driven, independent work Fluent conversational and technical English Qualified to work in US Additional pluses to application: Experience in development of topical drug formulations Experience in analytical methods (HPLC, spectroscopy, radiotracer) Knowledge of skin biology or expertise in skin permeation measurements Experience in resolving formulations scale-up issues Track record of innovation or patent inventorship Industrial experience WE have a unique capability for solving skin delivery or anti-delivery problems for pharmaceutical, medical device and personal care products. fqubed?s business is founded on proprietary compositions that function at the molecular level to modulate the barrier properties of skin and on high throughput experimentation platforms developed for screening how formulations affect skin properties such as permeability. fqubed, Inc. is based in San Diego, CA and pursues business relationships on a global basis.

Chemical Expert

Assisting in the privatisation of companies in the chemical industry; leading a project team of lawyers and auditors

Postdoctoral position in peptide/protein NMR

This position is available starting September 2006 in the laboratory of Dr. Noel Lazo in the Department of Chemistry at Clark University in Worcester, MA (40 miles west of Boston). Peptides and proteins of biomedical relevance will be studied including those associated with various forms of amyloidoses. Experience in solving structures and/or solid-state NMR is a plus. Instrumentation includes a 600 MHz Varian Inova for solution-state studies and a 400 MHz Varian Inova for solid-state studies.

Post-Doc Molecular Dynamics Proteins

Molecular dynamics of protein-surfactant systems docking studies Must be able to work with major programs for protein molecular dynamics like Gromacs or similar and molecular visualization tools Experience in Linux OS

chemists

synthetic organic chemistry analytical chemistry

R&D chemists

M sc in medicinal chemistry with two year experience in synthetic organic chemistry

chemistr

to become a good chemist

if any suitable

I will do any sequence searching in the base formats of Genomics,Proteomics and protien structures developing,

Biochemist

Medicinal and Computational Chemistry.

Biochemist

Bio Chemist Consultant

Organic Chemistry

Head New Drug Discovery

Role The person is responsible for managing the chemistry groups in support of small molecule drug discovery and synthesis of larger amounts of intermediates or final compounds. Apart from managing the chemistry department, the person is heading his own group, working on scientific projects. Therefore, the HOD has Group Leader responsibilities also. The position requires profound knowledge within medicinal chemistry to give advice on drug design, synthetic approach and analysis of SAR as well as very good knowledge of organic chemistry to contribute to the selection of appropriate synthetic routes. It also involves interaction with scientists from various disciplines including computational chemists, medicinal chemists, and biologists. The person should provide leadership and direction to scientists. Must play a key role in attracting talent. Experience About 10 years of relevant experience in managerial position. Must understand the aspects of Drug Discovery and preclinical development. Previous exposure to an international scientific environment is considered as beneficial. Job Responsibilities: As head of department the person is responsible for the organization of scientific work within the respective department and for the distribution of the same to the department groups. He discusses deliverables and timelines jointly with the senior management and finally is responsible for enforcement within his department. He delegates scientific responsibility for the respective research projects to his Group Leaders and fosters scientific exchange with other functions of the respective project group within the company or with scientists at other locations. He challenges the various approaches of the Group Leaders and he is responsible for the alignment with the expectations from the senior management. In his function he has to assure cost efficiency. As a leader, the HOD plays an important role in fostering the Core Values and functions as a leading example in living the Core Values.

Analytical Chemist

Thorough knowledge of Analytical Chemistry, Good Analytical Skills, ability to handle scientific instrumentation like GC, HPLC, FTIR, UV etc, perseverance & hard working, Good writing and drafting skills in Reporting, Understanding Regulatory requirement for compliance (Pharmacoepial), hands on experience in Computer Applications M.Sc-Analytical Chemistry / B.Pharm / M.Sc Chemistry with experience in QC

Senior Research Scientist Bioanalytical

Qualifications ? M.Sc / M.Pharm Exp ? 8 ? 10yrs experience The candidate should have good experience in BA/BE Studies in good GLP Labs or in Clinical Research Organizations He/she should be experienced in handling LCMS/MS.

Group Leader(Project & Engg.)

Group Leader(Project & Engg.)- Educational Qualification: BE (Mechanical), Experience: Mnimum 10 yrs experience in setting up of API facilities (including expansion) along with experience in maintenance of the API units. Salary: Best in Industry Location: Bangalore India

Project Leader(Analytical R&D)

Pharma MNC headquartered Canada requires for their Bangalore operations (India) for the following positions Project Leader(Analytical R&D) Educational Qualification: MSc /Phd Chemistry Experience: Minimum- 6 -8 yrs, MSc/Phd , work experience in API unit Salary: Best in Industry Location: Bangalore India

Group Leader(QC)

Mini.10 yrs experience,MSc /Phd, work experience with API unit

Shift in charge

Chemical expert

Support in the privatisation of state onwed companies in the chemical sector due diligence of the company, co-ordinating international and local expert teams (legal, financial, technical)

Bionformatics

drug dsigning&homologymodeling

Computational Chemist

We are currently seeking scientists in computational chemistry to join a Discovery Chemistry team. This position requires the use of computational approaches to aid in the design of novel molecules and molecule libraries for optimization of bioactivity and for hit discovery, developing new proprietary technologies and working as part of an interdisciplinary team. It would be great if you had a strong background in one of the following areas: QSAR, library design, or diversity analysis. Experience in UNIX operating systems, C/Fortran, scripting languages such as Perl, and/or web-based applications is a requirement, as is familiarity with commercial software and database packages. We hope that you enjoy interacting with other computational and synthetic chemists, IT professionals, and others to deliver enterprise solutions for small molecule library design and synthesis. Excellent organizational and communication skills would be great.

biochemist

drug desining or quality controller

biochemist

drug desining or quality controller

biochemist

drug desining or quality controller,research biochemist

biochemist

drug desining or quality controller

Computational Chemist

We are looking for a computational chemist to join our team. The person will be an integral part of our drug discovery team and will be expected to work very closely with synthetic chemists, informatics scientists, biologists and microwave engineers. Requirements: - combinatorial library design. - structure-based ligand design. - pharmacophore hypothesis generation. - QSAR/QSPR. (Quantitative Structure Activity Relationship) (Quantitative Structure Property Relationship) - VERY strong communication skills. Desired -Proficiency in a modern programming language and Monte Carlo simulation experience is strongly The ideal candidate will have a Ph.D. in chemistry, biophysics, or a related discipline with at least 2 years industrial experience. Due to the interdisciplinary nature of the position, excellent written and oral communication skills are essential.

Co-Founder

Bioinformatics: Senior Computational Human Genetics Computational Biologist to redefine "Cutting Edge" Sick of worrying about whether or not your next paycheck is going to clear? I have just the Cure. My cutting edge Biotech client company is looking for an expert in computational biology support and scientific input to be an integral part of their Human Genetics and Drug Discovery programs. This will entail analysis of genomic sequences, gene expression and/or protein-protein interaction data, gene identification, functional annotation and drug discovery. You obviously must be bright. A Ph.D. in Human Genetics, Biochemistry or a related field is required. Additionally, you must have experience with gene discovery and analysis from human genomic sequences, in-depth understanding and interpretation of literature, SNP and expression data and experience with state-of-the-art tools, methods and databases along with one year of perl experience. For meeting these requirements you will be afforded the priveledge of being a part of one of the most advanced teams in the genomic arena. This is a company that is flushed with cash and looking for only the very best to add to a star studded roster

Research Scientist, Medicinal Chemistry

Leading biopharm company in the SF Bay Area engaged in the discovery and development of infectious disease therapeutics. Responsible for the design, synthesis, purification and characterization of novelk small molecules for biological evaluation. Requires Ph.D. in medicinal/organic chemistry with post-doctoral experience in synthetic organic/medicinal chemistry. Knowledge of multi-step synthesis and modern spectroscopic techniques. Must have excellent communication skills; and the ability to work independently in a fast paced team environment.

B.SC (CHEMISTRY)PASSED OUT IN, 2003OR 2004 OR 2005

FRESHER

Cheminformatics Scientist

You will develop automated methods of combining bioinformatic and cheminformatic algorithms to models to help discover and optimize potential lead compounds for families of drug targets. You will need a PhD or equivalent, 3 years of applicable experience, familiarity with pharmacophore analysis, QSAR and bioinformatics, and demonstrated expertise in computational chemistry, algorithm development, computer programming (Java, Perl, C++) and statistics.

POSTDOCTORAL POSITION IN MOLECULAR MODELING AT THE HORMEL INSTITUTE UNIVERSITY OF MINNESOTA A postdoctoral position is available immediately at the Hormel Institute, an independent research branch of the University of Minnesota, located in Austin, MN. The successful candidate will work closely with the Cellular and Molecular Biology group at the Hormel Institute, IBM and the Minnesota Supercomputing Institute. The position will primarily involve collaborative fundamental Cancer research using a variety of computational methods that will be corroborated with experimental findings. The successful candidate will focus on the computational and modeling aspects in three primary areas of cancer research involving the study of protein-protein interactions along cellular signaling pathways, investigation of small molecule interactions with proteins, and the development of focus chemical libraries for chemical screening against protein targets. The successful candidate will be located at the University of Minnesota Supercomputing Institute in the Twin Cities with access to a wide variety of computer systems and state-of-the-art computational software packages. In addition, the successful candidate will have access to Blue Gene/L, the most powerful supercomputer, at the OnDemand Center located at IBM Rochester, Minnesota. Regular trips to the Hormel Institute in Austin, Minnesota are expected. Presentation of results in written reports or peer reviewed journal articles and seminars or symposia will be required. A Ph.D. in chemistry, physics, biology or chemical physics is required. The successful candidate will have demonstrated experience applying molecular simulations packages such as Gaussian03, AMBER, LAMMPS, Docking programs, bioinformatics software and commonly used molecular modeling interface. Strong programming and knowledge of scripting languages is a plus. Strong written and oral communications skills are required. To apply, please your curriculum vitae to: ambode@hi.umn.edu.

Manager R&D

developemnt & scale up of aroma chemicals

Laboratory Equipment Systems Technician

Laboratory Equipment Systems Technician Wanted: For reseller of new and reconditioned laboratory Equipment, parts, supplies, repair services and technical support. We are seeking a qualified individual to with a chemistry background to help us provide the highest quality service in the industry. This entry-level position requires experience operating and maintaining HP and Agilent GCs, GC/MS, and associated Data Systems. Willingness to learn and work within a team is required. Alpha Omega Technologies in beautiful Brielle, NJ offers an extensive benefits package. Fax your resume to Human Resources at (732) 292-2311 or e-mail to spaleologos@aoti.net

Group Leader - Computer-Aided Drug Discovery

Group Leader ? Computer-Aided Drug Discovery Our client is one of the world?s leading pharmaceutical companies. They have retained us to conduct an exclusive search for qualified candidates for Group Leader ? Computer-Aided Drug Discovery. The Group Leader (CADD) will lead a team of modellers that partners with medicinal chemistry to deliver high quality leads or drug candidates within competitive timeframes, following high scientific standards. The Group Leader will effectively lead, mentor and develop his/her reports and contributes to the further development of the practice of CADD within the company. Responsibilities will include: Lead a CADD team typically comprised of PhD level direct reports working in the design and execution of drug discovery programs. The Group Leader and direct reports are expected to be influential project team members, possibly leaders. Ensure the delivery of high quality leads, CSPs and sPOCs within competitive timeframes. Drive the CADD strategy for assigned projects and contribute to the broader strategy of the CADD Unit and the associated Disease Areas (DAs) or Functional Areas (FAs). Collaborate across GDC (including with LSC) and relevant DAs/FAs, as well as with other groups such as Metabolism and Pharmacokinetics, Discovery Technologies and IT. Serve as a key contributor to the conception and execution of the science, both with respect to CADD and other aspects of drug discovery. Contribute to the conception and initiation of new programs and methodology. Play a key role in defining and refining GDC strategy. Participate in the strategic planning and execution of broader projects and initiatives within GDC, in order to deliver the highest standards of medicinal chemistry for the company. Contribute to the further development of the practice of CADD at the company. Coordinate CADD outsourcing activities and/or collaboration where appropriate. Play a strategic and operational role in interactions with CROs, academic research groups, alliance partners and professional societies. Manage resources under his/her control to maximize the achievement of unit objectives. Participate in annual goal setting for CADD unit and direct reports. Provide performance feedback, create and implement development plans for subordinates with input from multiraters and other leaders when appropriate. Mentor direct reports in order to deliver maximal performance, employee development and teamwork. Create a positive, goal oriented and productive culture within the group. Determine key requirements for subordinate positions; recruit and evaluate candidates together with other leaders and HR. Participate in performance calibration across labs, and recruiting and retaining talent pool. Coach and advise subordinates in CADD, medicinal chemistry and related drug discovery sciences. Effectively communicate results and issues at team meetings and reviews, as well as in written and oral reports. Ensure the documentation of performed scientific work according to good laboratory practices and company standards. Ensure the group maintains the highest information security standards. Hold group members accountable for safety and security within their areas. Maintain a strong external network and high visibility for the company within the scientific communities by participating in scientific meetings and developing and delivering high quality publications and presentations. We seek candidates who meet the following criteria: A PhD with five or more years of pharmaceutical industry experience. A proven track record as a scientific leader within the pharmaceutical industry. This record will be the amalgam of the following: successful project contributions, innovative approaches that impact projects, effective resource utilization, publications/presentations/patents, demonstrated oral and written communication skills, demonstrated managerial and leadership skills. Do you have the skills and experience our client requires, and do you want to advance your career in a leadership role with one of the world?s premier pharmaceutical companies? If so, please email your resume as a Word attachment to dan@jobsrecruiting.com , reference code 2142-M. No calls or faxes, please. Include your daytime phone number and we will contact you confidentially or reply to your email. Fairway Consulting Group is a leading executive search firm dedicated to the pharmaceutical and biotech industries. www.fairwayconsultinggroup.com or www.jobsrecruiting.com

Postdoctoral researcher

Postdoctoral researcher in theoretical biophysical science. Preferred candidates should have excellent computer skills, experience with molecular simulation, and a background in theoretical physical science, biophysics, or bioinformatics. The research interests of my group concern the application of statistical mechanics to complex systems, especially biopolymers. The particular research projects involved will depend on the background and interests of the postdoc, but possible topics include * the development of statistical theories of combinatorial libraries and sequence ensembles * the discovery of globular and membrane proteins using combinatorial methods and directed evolution * the modeling of molecular evolution * the design and characterization nonbiological folding molecules * protein folding, kinetics and structure prediction The opportunity also exists to work collaboratively with experimental researchers, including a possible joint computational/experimental position. Interested candidates should send a curriculum vita and three letters of recommendation to: Prof. Jeffery Saven Department of Chemistry University of Pennsylvania 231 S. 34th Street Philadelphia, PA 19104 Email: saven@sas.upenn.edu The University of Pennsylvania is an equal opportunity/affirmative action employer.

Process Development Chemist

We seek chemists with experience in process research development of APIs. Must be conversant with modern synthetic approaches and able to work independently. Several years experience required.

Technician supervisor in chemistry

Resume Name : Pandya Purvish Pinakinbhai Address : A/5 Niketa Appartment, B/H Mithaiwala Hall, Maninagar ,Ahmedabad-380008 Birthdate : 17-06-1986 Mobile No : (+91)9824003511 Phone No : (079)25460285 Nationality : Indian Religion : Hindu Language Known : Gujarati,Hindi,English Education Qualification : Passed S.S.C Examination in 2001 with 84% Passed B.Sc(in Chemistry) Examintion in 2006 With First Class (64%) Experience : Fresher Expected Salary :As per Rules

Research Associate ? Discovery Chemistry

Qualification - M.Sc (Organic Chemistry) Preferably Pune, Mumbai or Hyderabad Universities with minimum 1st Division in Academics Experience ? 1 -2 yrs Should have experience in Discovery Chemistry Research. Synthesis of New Chemical Entities

Research Associate ? Pharmacology

Qualification: - M. Pharm (Pharmacology) / M. V. Sc Experience ? 1-2yrs He should have exposure in pre-clinical/ in vivo studies in animal models in therapeutic areas of Asthma, diabetes, obesity & anti inflammatory.

RESEACH ASSOCITE

I HAVE EXPEREINCE IN PROTEN MODELING DRUG DESIGN

RESEACH ASSOCITE

I HAVE COMPLETED BSC WITH CHEMISTRY AND MSC WITH BIO CHEMISTRY IHAVE CAPABILITY TO HANDLE ANY EQUPEMENT IN MY RELATED MY FILD . I HAVE EXPERENCE IN PROTEN MODELING AND DRUG DESIGN

CURRICULUM VITAE N.SIVA GANGI REDDY E.W.S 408, ROAD NO :2, K.P.H.B COLONY, HYDERABAD,500072. E-mail: sivagreddy_n@yahoo.com Cell:9949793022 CAREER OBJECTIVE: To achieve a unique identity in the present competitive field and seeking a successful position. Intend to build a career with leading corporate of interactive environment with committed and dedicated people who will help me to explore myself fully and realize my potential. EDUCATION QUALIFICATIONS ? M.Sc in Chemistry from S.V.University collage, Tirupathi, with 65.25% in april 2005. ? B.Sc (BBC) from Govt college for men ,Kadapa,(S.V.University) with 59.9% in march 2003. ? INTERMEDIATE (BPC) from St joseph?s Junior college , kadapa, with 69.2% in march 1999. ? SSC from Z.P.G.H.School, Payasampalli,with 69% in march 1997. PERSONAL SKILLS ? Comprehensive problem solving, excellent verbal and written communication skills, ? willing to work in teams, willingness to learn, addressing crowds and adaptability. . SOFTWARE SKILLS ? Ms-Office (Ms-Word, Excel, Power Point) ? Origin 5.0, Chem Window 4.5, Chem Draw 6.0 and ISIS draw 2.4 PERSONAL PROFILE Name : N.SIVA GANGI REDDY Date of Birth : 10th June 1980 Nationality : Indian Sex : Male Marital status : Unmarried Address for correspondence : Mammu siddu palli (V) Pendlimarri(M) Kadapa (D) (516216) DECLARATION I hereby declare that the above written particulars are true to the best of my knowledge and belief. Place : Date : (N.SIVA GANGI REDDY)

Staff Investigator, Organic Chemistry

Staff Investigator, Organic Chemistry PhD in Organic Drug discovery provides a challenging environment in which to utilize your technical problem solving expertise in the application of organic synthetic chemistry to discovering new molecules designed for biological activity. The successful candidates will work in highly motivated, multifunctional teams, applying their proven synthetic skills to the application of our state-of-the-art parallel-automated chemistry platform to all aspects of Drug discovery. Here you will be exposed to all aspects of Drug discovery, advancing your knowledge and making valuable contributions to our Discovery pipeline by working in the area of library design and small molecule optimization towards biological targets. PhD in Organic Chemistry or related. Experience with solid-phase organic synthesis and characterization of biologically relevant small molecules necessary.. Familiarity with routine analytical techniques, including NMR, HPLC, and MS is required. or laboratory automation is a plus. The ideal candidate will combine their blend of motivation and synthetic skills with our team orientated Drug discovery programs to increase the success rate and efficiency of discovering and optimizing new potential medicines

Please describe the job you are offering.

Process Validation Specialist

RESPONSIBILITIES: Monitors the implementation of validation protocols and documents that the manufacturing process is being executed as outlined in the MMDs/PMDs Alerts Validation management of process deviations during manufacture of validation lots Samples granulation and finished dosage forms Perform physical testing for process validation samples Ensure all generated documentation is accurate and in accordance with SOPs and cGMPs Prepares all materials (eg., Labels, bottles, sample records, etc.) for each validation lot Organizing stored samples and updating datebases Perform other duties as required SKILLS AND QUALIFICATIONS Diploma and/or preferably a B.Sc. in a Science related area of study (Chemistry, Biochemistry or Microbiology) Strong interpersonal, communication (written and oral), organizational and analytical skills High level of initiative and ability to work on multiple priorities Demonstrated commitment to team work is essential Familiarity with pharmaceutical regulatory requirements would be an asset Knowledge of Microsoft office would also be considered as an asset

research chemist

work as a reseach chemist, to develope the process

Synthtic Organic or Polymer Chemist

Industrial Research Limited (IRL) is New Zealand?s leading scientific research organisation. Through the creation of intellectual property and world-class science, our role is to discover and develop leading-edge technologies then bring them to commercial reality. An exciting opportunity has arisen at Gracefield (Lower Hutt) to work within a dynamic team of synthetic organic chemists. The role would suit an experienced synthetic chemist preferably with a PhD in the area of synthetic or polymer chemistry. The position will contribute to the preparation, characterisation and optimisation of chromophores and their corresponding polymers for use in second order nonlinear optics. The role is on a fixed term for two years, due to the availability of funding for the project. The key accountabilities of this role are to: Perform experimental research at a laboratory scale; Work closely with the research leader towards the delivery of project outcomes; Process and analyse results and conclusions to the scientific community, partners and clients; Adhere to safety and quality systems. The specific skills and experience we are looking for are: Minimum of a Masters degree, preferably a PhD, in synthetic organic, or polymer chemistry; Experience in modern synthetic organic chemistry techniques, especially with respect to any non-natural products, polymers or materials; Thorough understanding and experience in organic synthesis at laboratory level; Experience in computational modelling e.g. MOPAC is desirable; Ability to research independently and publish results as required. Further information about the role can be obtained by contacting Andrew Kay on (04) 931 3210 or by email on a.kay@irl.cri.nz. Applications close on Friday 11 August 2006. Industrial Research Limited is an Equal Opportunities Employer

Lead Generation Informatics - ChemoInformatics Scientist

The Chemo-Informatics group, in my company, has a position open for a dynamic individual with a excellent track records in Chemo-Informatics, Chemometrics, Computational Chemistry and/or Molecular Modeling. In this position you will be expected to invent, develop, and/or implement algorithms, methods and methodologies in one or more of the following areas: knowledge-base reasoning systems, large data set analysis / chemometrics, data mining, automatic pharmacophore perception, physico-chemical and bio-pharmaceutic property predictions, virtual screening and diversity analysis. You will also participate in the design, integration, deployment of software or in-house developed tools associated with drug discovery. You will closely work with medicinal chemistry, molecular modelling, compound management, screening, drug metabolism and pharmaco-kinetic department, drug-safety department, and information systems. You will closely interact with global and local project teams and with the other informatics groups located on different sites (USA, Germany). This position requires a PhD in Computational Chemistry, or in Molecular Modeling or in Chemometrics with a minimum of one or two years of post-doctoral experience preferably in pharmaceutical industry. Knowledge of Bioinformatics is an asset. Experience in using large database systems (data, 2D, 3D), good programming and scripting skills (C/C++, Java, Perl, Python, VB, SQL, ..), knowledge of Linux/Unix operating environment as well as of commercial drug discovery software is required. A good understanding of medicinal chemistry is highly desirable. Strong interpersonal skills, capacity and enthusiasm for working in an international, multi-disciplinary team as well as in a project managed environment are required. This position is located in Paris (France).

Ink Formulation Lab Chemical Technician

WetBench Chemistry experience is must. Local to San Diego. Responsibilities. - Mixing and preparing inks and ink component solutions. - Filling printheads with ink and provide to ink chemist for evaluation. - Analyze data using statistical methods

Research assistant prof./Senior research scientist/Research scientist/Postdoctoral fellows!

Applications for the posts of (Research assistant prof./Senior research scientist/Research Scientist/Postdoctoral fellow) are invited in the broad areas of, (1) theoretical and computational chemistry, computational material science, computational condensed matter physics (Candidates should have a strong background either in computational chemistry or computational condensed matter physics and should have experience in developing ab initio method, DFT, or ab initio MD simulation codes). (2) nano-physics/chemistry (experiments and theory) (3) organic/inorganic synthetic chemists. All positions are initially for one year but can be extended, based on the performance of the candidates. Salary: Postdoc $25,000/year (+ one-month salary ~$2,100 for pension every year), Research assistant prof $31,500/year (+ one-month salary ~$2,600 for pension every year), Exceptional candidates can receive higher salaries. Special benefits: Minimal lodging expenses ($105/month for shared accommodation), ($420/month for individual accommodation: married candidates only), Cafeteria (~$2/meal), Insurance: 4% of monthly salary, No tax according to bilateral law between Korea and related countries (most countries belong to this category). The research in the Center for Superfunctional Materials is predominantly focussed on the use of computational methodologies in the design and development of novel bio- and nanomaterials (see the center?s research publication list for more details, http://csm.postech.ac.kr/csm2/index.php?menu=3&year=2006). Candidates interested in method and code development are also invited to apply. The center has close to 50 DEC and SGI workstations, a few Linux clusters, and also has access to the IBM-SP2 and NECSX machines in Daejon. Pohang University of Science and Technology has one of the most advanced digital libraries in the eastern hemisphere and also has an excellent gigabit computer network. Pohang is a lovely sea-side town with a number of hill-trails and scenic beaches. It has also a growing international community. Interested candidates may send their application to Professor Kwang S. Kim Center for Superfunctional Materials, Department of Chemistry, Pohang University of Science and Technology (POSTECH), San 31, Hyojadong, Namgu Pohang 790-784, Korea, (E-mail: kim@postech.ac.kr Phone: +82 54 279 2110, Fax: +82 54 279 8137) as soon as possible.

protein moddeling,drug targetting&design

rotein moddeling,drug targetting&design.

RESEARCH SCIENTIST

RESEARCH SCIENTIST OR REGULATORY AFFAIRS

Research Associate/Research Scientist

Min 4-5 yrs of exp. in Analytical Development Lab. Should have handled GC, GCMS and HPLC. Must possess good analytical data interpretation, trouble shooting and experiment planning skills. Awareness of GLP and GMP and expertise in developing GC methods for low volatile fluorinated compounds will be an added advantage

postdoctoral research associate

The Faculty of Pharmacy at the University of Lisbon and the Research Center in Pharmaceutical Sciences (CECF) are seeking two postdoctoral research associates to work in medicinal chemistry projects on the design and synthesis of novel molecules directed towards several key therapeutic targets related to neurodegenerative diseases. Candidates must have a PhD in Chemistry or a closely related area and significant post-doctoral research experience in organic synthesis in the context of medicinal chemistry projects and ideally have some experience in biological evaluation. The successful applicants will be expected to maintain an externally funded research program within the Medicinal Chemistry Division. The appointees will also play a major role in the organisation and running of the medicinal chemistry laboratory, including assisting with supervision of PhD students.

postdoctoral research associate

We are seeking one postdoctoral research associate to work in medicinal chemistry projects on the design of novel molecules directed towards several key therapeutic targets. Applicants should have a PhD in Chemistry or a closely related area and significant post-doctoral research experience is an equal opportunity employer and actively seeks diversity among its employees.in computational chemistry in the context of medicinal chemistry projects and ideally have some experience in biological evaluation. The position requires good oral and written communication skills and offers the opportunity to carry out basic scientific research within a highly motivated and productive team. The successful applicants will be expected to maintain an externally funded research program within the Medicinal Chemistry Division. The appointees will also play a major role in the organisation and running of the molecular modelling laboratory, including assisting with supervision of PhD students. Experience The ideal candidate should have a Ph.D. in chemistry, pharmacy, or related fields with a strong background in physical chemistry and at least three years of postdoctoral experience. Successful applicants will have experience in molecular simulation and standard molecular mechanics software packages such as Amber, CHARMM, Gaussian, Gromacs, or NAMD. Practical knowledge of ligand-based modelling techniques is an advantage. Strong computational skills are desired including scientific programming experience and experience with UNIX environments. An ideal candidate would be highly competent in a number of programming and scripting languages such as C++, FORTRAN, perl, and python. Candidate must also display exceptional motivation and the ability and desire to work both independently and as part of a team and show an active interest in medicinal chemistry. Good oral and written communication skills are essential.

Research Scientist

Exp. in Process development and technology transfers of APIs for regulated market and/or in handling Custom Chemical Synthesis projects. The incumbent must possess sound laboratory skills and must be well versed with latest reactions and reagents. Exposure to IPR, global regulatory requirements and relevant analytical techniques.

Research Associate

MSc opr PhD (Analytical Chemistry) with min. 3 yrs exp in Analytical Method development and Validation of APIs for regulated market. Hands on exp. on HPLC, GC, GC-HS, FT-IR etc and independent interpretation of analytical results is must. Exposure to preparative HPLC, GC-MS LC_MS, DSC-TGA, XRPD, impurity profiling as well as GLP.

Research Scientist

MSc or PhD (Organic Chemistry) with industrial experience (min 2 yrs) in process development and technology transfers of APIs for regualted market and/or in handling Custom Chemical Synthesis projects. The incumbent must possess sound laboratory skills and must be well versed with latest reactions and reagents. Exposure to IPR, global regulatory reqts. and relevant analytical techniques.

Drug desining/protein modeling

The Manager of Environmental Fate and Metabolism assumes a wide range of scientific and technical duties associated with various animal, aquatic, plant and soil environmental fate and metabolism projects performed at Springborn Smithers Laboratories. Responsible for the training and supervision of the professional and technical staff, including reviews, promotions, and accounting of time worked. The Manager of Environmental Fate and Metabolism is responsible to enhance the performance of the scientific team and its individuals by developing and instituting novel approaches to animal, aquatic, plant and soil environmental fate and metabolism, problem-solving and the development and maintenance of customer relations leading to new business opportunities. The Manager will effectively communicate and collaborate with peers regarding study schedules, study conduct and new technologies. Duties include training scientific staff, managing maintenance and calibration of laboratory equipment, reviewing and summarizing data, problem solving, technical and business communications with peers and customers.

Software Programmer/Architect-Tnk-ISTL

Design and development of the Processor Architecture validation tools.Job involved design of the tool involving proprietary operating system at the system programming level. These tools are used to bringup & test new processor and processor based System. Candidate will be working on the Advanced multi-core processor architecture based systems. Work will involve understanding processor architecture, developing algorithm to validate processor( and system) efficiently.

GUI Developer-IBM-ISL

Design, code and test user interfaces and graphical user interfaces in a electronic design automation application. Also develop high speed 2D graphical renderings of circuit designs. Good communication skills are required to interact with the applications users and to be able to design the user interfaces in a consistent and user friendly manner. Program on AIX and Linux based workstations in the latest programming languages including C/C++, Tcl/Tk, Motif X11 and Qt.

Computational Lithogrpahy-IBM-ISL

"Dataprep Engineer - This job can encompass several potentential roles (listed below). As experience is gained, an emplyeee will increase their scope to include additonal roles, or possibly move to a new role. Likely initial roles would be Boolean developer, and/or Infrastructure developer (depending on the skills of the candidate). Layout Test Engineer - In this role the person is expected to have basic layout editing skills on an industry standard layout editing tools. In this role the engineer is expected to have the creative ability to generate unique test patterns given a set of requirements and later be able to generate an array of test structures which are comprehensive to create a unique test suite of all patterns in the domain of physical verification in particular RET technologies. Knowledge of ground rules, exposure to memory cell designs, microprocessor design is a big plus. "

biochemistry

as scientist offiser1

job

stuff

R&D Manager (FTE)

Position: R&D Manager Department: R&D Location: Bay Area (San Jose) The following is not intended to represent an all-inclusive list of job responsibilities, but to outline the ESSENTIAL FUNCTIONS of the position. General Description: Responsible for primary hiring, on-time performance appraisals, coaching/counseling, employee development and necessary communications to regarding performance issues. Essential Functions: �Plans, organizes, staffs, directs and controls the engineering function within appropriate guidelines, policies and regulations. �Establishes and guides goals and accomplishments of the team/department. �Responsible for primary hiring, on-time performance appraisals, coaching/counseling, employee development and necessary communications to regarding performance issues. �Maintains the timeliness of the engineering schedule to insure effective administration of time standard practices. �Ensures compliance with all regulatory and compliance activities within prescribed area. �Develops annual budget, status reports and other related communications. �Operates within budget and organizations guidelines and philosophy by implementing cost reduction programs through value analysis. �Leads special engineering or related discipline projects/assignments. �Provides technical expertise to engineers in the area of failure modes, failure analysis, and test requirements. �Plans and coordinates with other engineering areas to ensure the timely and efficient product production. �Assist the VP of R&D in overall management of the department as assigned. �Works as a key member of an interdisciplinary business team to drive business performance. �Accountable for all record-keeping as appropriate and in accordance with the company's specifications. �Responsible for both product engineering and new product development. �Drive and develop increased team engagement over time. �Understand organizational need to remove under performers and develop the next generation of leaders. �Talent Exportation. �Responsible for establishing the budget and strategic directions achieving goals. �Expected to handle complex or difficult situations as appropriate. �Signs as the final release authority on engineering drawings and other documentation. QUALIFICATIONS: �Undergraduate degree in Engineering or with equivalent schooling in statistics, mech. of materials, fatigue and stress analysis, and calculus. MS/MBA desired. � At least five (5) years experience working as an engineer on successful product development efforts. At least two (2) years of management responsibility. Specific experience in Marketing, or Quality, and/ or Operations is preferred. �Must be PC literate. �Basic skills - Time management, project management, reports and budget, stress management, conflict management, re-engineering, customer service, ISO, Windows, advanced computer, ERP, statistics, manufacturing process, metrology, auditing, mechanical support, blue print reading, financial systems �Functional skills - Product knowledge, material flow and paperwork. �FDA and ISO design and process control systems �Financial systems, HR system, manufacturing systems, organizational structure and design engineering interface. �Ability to make decisions impacting team members regarding training, coaching/counseling and appropriate follow-up. �Ability to make decisions in regards to compliance issues, product reliability and analysis of testing methodologies. �Ability to make decisions impacting team members regarding training, coaching/counseling and appropriate follow-up. �Ability to make decisions in regards to compliance issues, product reliability and analysis of testing methodologies. �Job demands include prolonged sitting, may need to stoop, bend and stand as appropriate. �Requires coordination of hands and/or eye/hand/foot. �Meets cognitive demands to include visual discrimination/memory, auditory discrimination/memory reading ability, independent decision making and retention of specific knowledge. �Requires use of safety glasses in designated areas.

PKDM Study Director

Study Directory -- PKDM Our client seeks an experienced Study Director to lead high visibility PKDM studies for key customers. Inteface directly with study sponsors, prepare study protocols, coordinate and oversee internal resources across all major departments, analyze data, interpret results, and prepare study reports. Superior compensation and work environment! Your work experience must include at least 5 years of extenisve, hands-on pharmacokinetic and drug metabolism studies with demonstrated career growth and increased responsibility for overall study success. Naturally this position requires leadership ability, appropriate verbal and written communications skills, and relevant computer and statitistical analysis skills. A Ph.D. is essential for this high visibility position. For immediate, confidential consideration, please email your resume/CV to Neil Owrutsky, mailto:precision.staffing@comcast.net 410-356-8370

Research Associate-Synthetic Organic Chemistry-Big Pharma

This position requires a minimum of a M.S. degree or B.S. plus 5-8 years experience as a chemist. The candidate must be able to work independently and have excellent written and oral communication skills. Would prefer a candidate with a strong Medicinal Chemistry and Combinatorial Chemistry background as well. - In the high throughput discovery environment, he/she will focus on the synthesis of designed templates for targeted libraries to support therapeutic projects; develop new reaction protocols necessary for the library production; prepare hits from the libraries for further biological evaluation. This position is for a scientist with strong skills and experience in synthetic organic chemistry. The candidate must be competent in all standard organic synthetic and purification techniques such as chromatography, fractional distillation, crystallization and the interpretation of spectra. Experience in parallel synthesis is a plus. He/She is also required to write reaction protocols and research reports, and to present work in a team setting periodically.

Senior CRA

Urgent requirement for one of our top clients located in ?Mountain View, CA?. Please contact me at your earliest convenience, along with job No. SCR_110307 to anitha.maturi@makrotech.com Description: Monitor clinical trials, study sites, and clinical data. Ensure compliance with protocol and overall clinical objectives and GCP. Provide project support to clinical programs with minimum supervision. Manage clinical study sites including study site start up and close-out. Ensure study sites follow company?s SOPs and GCP. Assist in management of relationships with vendors within and across studies. Provide mentoring and work leadership to junior CRAs. Assist in development of clinical study protocols and take ownership of their implementation where appropriate. Monitoring of clinical study sites (+/-CRO staff) as required Ensures identified clinical study issues are resolved; implements and monitors corrective action. Provide input into development of Case Report Forms. Facilitate the development of study-specific clinical trial materials. Attend meeting(s) with external vendors, CROs, Investigative sites, Investigator meetings and scientific meetings. Requirements: Bachelor's degree or equivalent. RN with evidence of further study considered. Major course of study in Science or Health-related preferred. 5 years experience in Clinical Research or related field. Proven track record to deliver key study deliverables in support of operational milestones. Demonstrates good understanding of ICH/GCP, and US FDA regulations as applied to clinical research. Contact: The most effective way of communication is via email please forward us your updated WORD FORMAT resume (Address, Contact number and email is must) to *** anitha.maturi@makrotech.com *** Please mention your best hourly rate, availability and visa status. Any questions, do feel free to email us.

Anchor

Anchor for an educational show on premier channel of India with sound academic record as in M.Sc , Ph.D Chemistry

Bioanalytical Scientist

Bioanalytical positions in Pennsylvania Agile1 seeks for a high profile global company Project Scientists, Group leaders or Sr. Project Scientist, Managers or Principal Scientists to be responsible for performing and overseeing all bioanalytical efforts for the quantitative analysis of vaccines products and therapeutic proteins, in support of the company manufacture of existing products, and late development of new products. Required Skill sets: � Education: Ph.D., or MS/BS in Biochemistry, or Biology. � Ability to develop and validate innovative analytical methodologies. � Knowledge of the principles required for modeling and interpretation of investigative data � Technical skills in virology, biochemistry, cell biology or immunology is desirable. A background in biochemical, tissue culture and immunological assays is preferred. Familiarity with cell banking, Elisa methods (both manual and automated), and neutralization tissue culture testing. � Experience with therapeutic biologics, vaccines and/or monoclonal antibodies is desirable � Understanding of operational and scientific management of critical reagents used in the testing of biological products would be a plus. � Ability to meet all safety and GMP requirements. � Work well independently using strong organizational, project and time management skills � Must have good documentation and communication skills, attention to detail, and strong problem-solving skills. Good written/oral communication and organizational skills are mandatory as communications across functional lines are required � Ability to work in a multidisciplinary team environment.

Commercial Managers

All company handling store, engg, productionand Excies dept. AS G.M Commercials.

Research Associate

Structure based drug design for a leading Pharma company in Bangalore. Role would involve you to be actively involved in molecular based drug design

Clinical Pharmacologist

Urgent requirement for one of our top clients located in ?Beverly, MA?. Please contact me at your earliest convenience, along with job No. CP_112407 to anitha.maturi@makrotech.com Description: PharmD, PhD or MD degree preferred with several years of relevant clinical and pharmaceutical industry experience in the planning and conducting of clinical trials (involvement in non-clinical trials a plus). 0-5 years clinical pharmacology and pharmacokinetics experience, including development of clinical pharmacology programs for new chemical entities. Experience directing clinical (and non-clinical) pharmacology studies and preparation of regulatory submissions. Responsibilities: Develop clinical pharmacology plans, design and direct clinical pharmacology studies. Work with Study Logistics, CROs and other vendors to execute clinical pharmacology studies. Will design clinical pharmacology studies and in conjunction with Study Logistics be responsible for protocol development, study implementation, analysis and reporting of results. Will be responsible for clinical pharmacology sections of Investigator Brochures, IND, CTD and other regulatory submissions. Preparation of relevant documentation, as well as high-quality evaluation and interpretation of clinical pharmacology data (pharmacokinetics, pharmacodynamics, safety, dose/concentration response) from clinical studies. Provide thoughtful interpretation of the PK/PD data obtained for the entire development program/s. Interaction and response to regulatory agencies. Contact: The most effective way of communication is via email please forward us your updated WORD FORMAT resume (Address, Contact number and email is must) to *** anitha.maturi@makrotech.com *** Please mention your best hourly rate, availability and visa status. Any questions, do feel free to email us.

PhD or Postdoc position in theoretical modeling of molecular dynamics Enthusiastic and creative researchers are sought for an interdisciplinary project in the Computational Molecular Biology group at FU Berlin. The project involves the development and application of new statistical and computational methods to understanding the dynamics of biomolecules. It is a theoretical project, but will be conducted in close collaboration with experimentalists. The biological processes of interest are protein and RNA folding as well as protein:ligand interaction. State-of-the-art experimental methods, such as Time-Resolved Single-Molecule FRET will be used. This project requires background in physics and applied mathematics as well as some programming skills. Background in Chemistry and Biology is helpful but not strictly required. The candidate is required to have a Diplom or MSc in an appropriate natural science or maths. Earliest start 01.01.08 Payment: 2/3 BAT IIa

Pharmacists (Retail)

The suitable candidates would be B.Pharm / D.Pharm with an experience range of 3 to 15 years, substantial part of which must be in retail sector. A thorough knowledge of drug classifications & drug retailing laws along with a customer-focused attitude, good communication skills & a pleasing personality is a must. Suitable Pharmacists could also be considered for the position of a store manager.

Post Doctoral Fellow

Simulation of Glycosidase reaction mechanisms: The successful candidate will be required to carry out simulations using CHARMM and GAMESS-UK. A knowledge of molecular dynamics is required while experience in QM/MM simulations of proteins will be an advantage. The position is a 1 year renewable up to 3 years. Programming in Fortran and scripting will be a significant advantage in carrying out the project. The candidate will be expected to assist the group leader training Masters and doctoral students.

Post Doctoral Fellow

Simulation of Transition metal complex catalytic reactions: The successful candidate will be required to carry out simulations using CHARMM and GAMESS-UK. A knowledge of molecular dynamics is required while experience in QM/MM condensed phase simulations will be an advantage. The position is a 1 year renewable up to 3 years. Programming in Fortran and scripting will be a significant advantage in carrying out the project. The candidate will be expected to assist the group leader training Masters and doctoral students.

Head - R&D

Gender: Male Qualification : PhD (Organic Chemistry) Exp: 8-14 yrs PhD in organic chemistry from a reputed university, having successful track record in process development and scale up of APIs and intermediates from well known pharma companies, with hands on experience in handling various sensitive reagents and unit operations. The knowledge of contract manufacturing is essential. Knowledge of IP, ICH guidelines, analytical method development and validation and safety awareness is must. Must have lead a team of atleast 4-6 scientists, should be a good team player, strategic thinker and a good communicator.

Computational Lithography Engineer

IBM Semiconductor Research and Development Center is looking for Exceptional Talent for its Computational Lithography Center in Bangalore, India. COMPUTATIONAL LITHOGRAPHY is a Resolution Enhancement Technique used, via computational software applications, to adjust design patterns on a chip and increase manufacturability. WHAT WE DO: OPPORTUNITIES: SKILLS: � Mask Dataprep � Design Finishing: a process to adjust customers design to follow ground rules required for manufacturing � Design Services: a process to generate dummy Fill & Hole shapes to provide suitable density for chip processing � Data Prep: Optical Proximity Correction Process � Advanced Resolution Enhancement Technique � Optical Rule Checking � Mask Dataprep OPC Developer: Develop and maintain software infrastructure using physical verification tools, and interact with integration and design teams to provide optical proximity corrections on design patterns and improve manufacturability. � Design Finishing Developer: Develop and maintain software infrastructure to adjust customer?s design to follow required ground rules. � Rearchitecture Developer: Using requirements provided, automate the newly architected mask dataprep process flow and improve quality of the system using software tools such as Perl. IBM is looking for college graduates and experienced professionals with solid engineering/programming skills. � Electrical Engineering or Computer Science (BS/BTech, MS/MTech) � Basic understanding of semiconductor devices, physics, & optics � Software Skills ? C, Java, Perl, Scripting language such as kornshell � Shape manipulation languages such as Calibre SVRF / Niagara RESUME / CV : Contact Neha Pareek (nepareek@in.ibm.com)

Cheif Scientific officer

TO head R&D

Research Associate Organic Chemist

Qualified candidates will be involved in the synthesis of novel organic compounds and the development of new synthetic technologies for drug discovery. Candidates should have BS/MS in organic chemistry with relevant research experience, and technical proficiency with synthetic organic chemistry, including multi-step organic synthesis, purification and characterization.

Software Engineer

Software Engineer This position is responsible for custom software development to support scientific applications in a large drug discovery organization. Responsibilities will include, but not be limited to: Design, development, testing, implementation and documentation of C# and PL/SQL application modules. In addition to tactical activities, the successful candidate will have the opportunity to develop informatics strategy and standards. Qualifications Bachelor's degree or advanced in a related scientific or technology discipline. Candidates with a degree in Chemistry are preferred. Minimum of four (4) years as a software developer in a corporate environment Demonstrated experience with the following: ASP.NET and C#; Visual Studio.NET; Oracle SQL and PL/SQL; HTML/DHTML; XML; JavaScript. Strong C# and PL/SQL programming skills are absolutely required Experience with any of the following is helpful but not required: Barcode Scanners and Printers; Analytical Chemistry devices (LCMS, NMR, HPLC); laboratory robotics Experience with software from Accelrys or MDL Excellent communication and organization skills Ability and desire to work in a team-oriented environment Proven experience to deliver IT solutions according to projects plans and assigned priorities Ability to work in a multi-project environment Lexicon is an Affirmative Action/Equal Opportunity Employer

Analytical Development Chemist

This company is on the cutting edge of the life sciences industry, and we have diverse career opportunities available for talented, experienced professionals. This Senior Analytical Chemist will explore, develop, and document new analytical methods for a wide variety of materials used in development and manufacture of polymer-based products including microarrays, electrophoresis polymers, biochromatography media, and related products. He/she will apply broad experience with spectroscopic, chromatographic, and other methods of analysis to the identification and quantitation of impurities in key raw materials, bulk intermediates, and the complex formulations used in our final products. This candidate will also play a key role in the development of correlations between impurity profiles and functional performance characteristics to establish appropriate QC release specifications for these materials, and will develop and transfer robust analytical methods to the appropriate Quality Control group for routine use. Additionally, this candidate will support manufacturing, research, and development functions in troubleshooting problems with products and processes. As appropriate, the candidate will identify new analytical instrumentation, supervise its installation, and identify and manage external suppliers of analytical services. Skills/Knowledge Required: A PhD degree in analytical chemistry and a minimum of five years of relevant industrial experience are required. Extensive expertise and experience with modern spectroscopic and chromatographic methods of analysis, including HPLC, GC, MS, IR, and NMR (and hyphenated combinations) is also required. Hands-on familiarity with ESCA, ATR-IR SEM and XRF is desirable. The candidate must exhibit excellent problem solving, decision-making and leadership skills and a demonstrated ability to manage multiple projects and to adapt to changing priorities. Excellent communication skills, both oral and written, and the ability to work collaboratively in a multidisciplinary team environment are essential.

computational chemist/Structural Biology

Protein Biochemist/Biophysist or Structural Biologist: The applicants must have a Ph.D. in Biochemistry, Biophysics, structural biology or related fields with a strong background and demonstrated capabilities in protein biochemistry (protein expression, purification and characterization), with emphasis in quantitative kinetic and biophysical characterization of proteins and protein-protein interaction. Applicants with strong skills in molecular modelling, protein design, and/or molecular electron microscopy are also encouraged to apply. Good writing and communication skills are important, and the ability to be a team player and interact with several groups is a must. Computational Chemist: The ideal candidate should have a PhD degree in chemistry, biochemistry, or structural biology with strong experience and publication record in one or more of the following areas, computational chemistry, molecular modeling and simulation of biological systems, protein engineering, structure-based drug design, protein-ligand interactions, in silico screening. The candidate will work on projects aimed at developing novel inhibitors and engineering unnatural variants of specific protein targets linked to inflammatory and autoimmune diseases. Experience with in silico screening is a plus, but not a requirement.

Sr Patent Analyst

? Prior art searching ? patent landscaping, ? Patent portfolio mining, ? Patent validity analysis, ? Patentability assessment, ? Competitive benchmarking, ? Infringement analysis, ? Patent litigation support, and ? Presenting patent information in maps and charts.

INDIAN TEACHERS WANTED

We are a co-educational school in Lagos, Nigeria,consisting of Nursery/Primary and Secondary schools. We seek science Indian teachers for our secondary school as well as a School Administrator who will be in charge of Nursery/Primary and Secondary schools. Salary is attractive and negotiable, accomodation provided. We prefer singles, widowed or divorced. 3-5 years experience needed.

Life Science Grid Opportunity

New Drug Discovery has become an expensive proposition for pharmaceutical companies. Projects get stalled in an internal laboratory causing valuable man hours and dollars to be burnt without any breakthroughs. We invite exceptionally bright, intelligent Masters, PhDs and Post-PhD scientists to join our Distributed Life Sciences Grid. If you are a subject matter expert in biochemistry, chemistry, toxicology, pharmacology, computational biology or any related subject areas, we need your help wherever you might be in the world. You will involve yourself in problem solving across 114 different areas of Pre-Clinical Discovery working for small as well as large pharmaceutical companies from the comfort of your computer workstation. You will be connected to our grid, solve a problem and be compensated for it. There is no need to relocate, change jobs or change your present career path. You will find involvement with us intellectually and monetarily fulfilling. Interested? Please email sandeep.shankar@coreprojectstech.com with your full cv or resume.

MEDICINAL CHEMISTRY JOB

TO SYNTHESISE AMND DESIGN THE DRUGS

GE - Sr. Chemist

GE Water & Process Technologies, a unit of GE Infrastructure, is a leading global supplier of water, wastewater and process systems solutions. GE delivers customer value by improving performance and product quality and by reducing operating costs and extending equipment life in a broad range of products and services. These products and services are used to optimize total water/process system performance, safeguard customer assets from corrosion, fouling and scaling, and protect the environment through water and energy conservation. For the GE site in Heverlee (Belgium), we are currently looking for a ?Sr. Chemist?. RESPONSIBILITIES Within the EMEA region (Europe/Middle East/Africa), the Sr. Chemist will fulfill the following responsibilities: ? lead technical productivity and direct material MCP projects and within the New Product Introduction process ensure all requirements to produce or deliver the product in EMEA is in place, ? facilitate introduction and ensure that new product formulations, manufacturing instructions, and product information are accurate, acceptable and communicated, ? maintain a good understanding of global GE Infrastructure product and raw material chemistries and ensure the knowledge is brought to the production plants wherever required to support the production process, ? coordinate formulatory laboratory testing (e.g. blending, stability, property), organe analytical tests and where required coordinate plant trails required to support and build chemical justification to the productivity and MCP projects, ? lead technical efforts for raw material sourcing (alternative / substitute) requests and liaise with global Applications Technology and Product Support to formalize approvals, ? communicate and understand regional MOC impact within a global organization including Technology, Product Support, Business Units and Supply Chain, ? manage the Management of Change process related to product formulations specifications and raw materials, ? investigate customer product, packaging and raw material incidents, identify the root cause, input to the QIA database and prepare the quarterly quality report, ? identify opportunities for product quality improvements and production efficiency together with the Technical Marketing and production units, ? create, implement and maintain ISO9000 procedures to improve product quality, ? investigate and approve actions required, to resolve production incidents, off-spec products, batch adjustments, reworks, smog?s and blend-offs in consultation with the Technology Management, ? comply with all GE Infractructure quality standards and initiatives. Education: ? You have minimum a Masters Degree or equivalent in Chemistry Experience: ? You have minimum 5 years of working experience ? You have working knowledge of surfactants, polymers and inorganic salts. ? You have a profound chemical understanding of analytical standards and procedures. Languages: ? Fluency in English ? Other European languages (French, Italian, Russian, ?) can be an advantage Skills: ? You are a highly motivated independent worker ? You have the natural drive for bringing solutions ? Your have got team leader skills ? You have good communication skills and can make complex chemical processes understandable to none chemically trained people ? You have the ability to prioritize and handle multiple topics, transitioning with minimum lost time ? You are pro-active and a problem solver ? You are willing to travel for your job (20%) ? You are PC literate OFFER - Competitive salary - Professional advantages of an environment that supports your development and recognizes your achievements - Work location: Heverlee

Senior Research Analyst

Ph D in Organic Chemistry -preferably freshers.

Senior research in Medicinal chemist

Required - Ph.D degree in organic chemistry or medicinal chemistry - more than 3-5 employment experience in ralated company - prefer nationality : India -candidated should have experience in total synthesis -required 3-5 per.

Computational methods development and applications

CMD Bioscience is a Connecticut based start-up biotech company that is developing and applying cutting-edge computational methods to identify therapeutic peptides. We are seeking daring and exceptionally motivated and creative computational scientists to help develop and apply our computational methods. Successful candidates for the computational methods development position will help develop and validate our second generation free energy function for predicting protein-protein binding free energies. . Successful candidates for the computational applications position will apply existing methods to design and optimize peptide candidates. Candidates for the computational methods development position should have a PhD in biophysics or a related field, excellent computer programming skills, experience developing methods for computational protein modeling and simulation, and good English language writing skills. Candidates for the computational methods application position should have at least a BS in biochemistry, medicinal chemistry, biophysics or a related field, hands-on experience with molecular modeling and simulation software, some experience with script writing, and good English language writing skills. All candidates should be willing to write and submit grants to obtain project funding. This is a unique and exciting opportunity for candidates to obtain an intellectually stimulating position at the ground level of a small, fast-paced and vibrant company.

Medicinal chemistry

Product Validation

New Product Validation Scientist Kelly Scientific Resources is currently searching for a Product Validation Scientist for a major pharmaceutical company in Miami, Florida. Our client is in need of a Scientist to support the Operations Technical Services Team in Product Validation. Duties: *Assist in the technology transfer/validation of products from R&D to commercial production *Prepare validation protocols and reports *Maintain validated systems in compliance with FDA guidelines *Support validation team in achieving best practices programs *Provide support to investigations as required. Requirements: *Bachelors of Science degree *3-5 years of experience in product validation in a pharmaceutical environment *Knowledge of FDA guidelines *Excellent oral and written communication skills *Proficiency in MS Office software applications Kelly Scientific Resources (KSR) is the leading scientific and clinical research staffing company in the world. We employ more than 700 clinical research professionals and 4,500 scientists on an average workday on a temporary, project and full-time basis in a broad spectrum of industries and disciplines. KSR has more than 100 locations in North Americas, Eruope and the Pacific Rim. Please visit us at www.kellyscientific.com to learn more. Kelly Services is an Equal Opportunity Employer

safety officer

complete safety look out

Principal Scientist

The job requires the person to have good understanding of the advancements in the field of chemoinfomatics and conceptualize the problems, design and execute the solutions with the use of advanced tools and technologies to meet the future demands of research activities in chemistry. The Company provides the opportunity to work on cutting edge projects and products, to work with best in-class team and globally renowned customers.

Scientist

postdoctoral researcher in Bioinformatics

We are seeking a bioinformatics postdoctoral researcher to join our lab. The successful candidate will work on datamining method and tool development in genomics, proteomics, and/or drug discovery, and will collaborate on a number of highly visible and productive NIH funded projects. RESPONSIBILITIES: The successful candidate will work on the development and applications of datamining methods and tools in an interdisciplinary and highly collaborative environment. Other duties may include database development and management. PREFERENCES: PhD in a relevant field. Experience in scientific programming using Perl and/or Java. Experience in developing databases with web applications. Strong quantitative background with solid mathematical skills. Strong knowledge in biology and/or chemistry. A good publication record. Good communication skills and the ability to work with an interdisciplinary team are essential for this position. Send curriculum vitae including a publication list, and names of three references

research associate

MAKING NCE MOLECULES

M.Sc. BioInformatics

Bioinformatics

VP/Head Medicinal Chemistry

Bring your big pharma experience to India.. Biosys, a division of Jubilant Organosys, is an integrated discovery collaborator to major pharmaceutical and biotech companies, accelerating global discovery efforts across multiple therapeutic areas. Jubilant Biosys engages in a range of functional discovery services and shared risk collaborations with multiple global partners. Located in Bangalore, the Jubilant Discovery Research Center is a state-of-the-art integrated discovery research facility (125,000 Sq Ft) with over 350 experienced and enthusiastic scientists, specializing in various aspects of discovery process to include: Discovery Biology, Medicinal Chemistry, Structural Biology, ADME, Toxicology, Pharmacology, Molecular Modeling, and Information Technology. due to our continued growth we are seeking a VP/Head of Medicinal Chemistry. Primary responsibilities include: ? Responsible for the entire medicinal chemistry in drug discovery & development process for the various business engagements and the organization. ? Handling portfolios as may be assigned, working with all other cross functional teams. ? Structuring /improvising processes and systems to ensure operational excellence in the organization. ? Working closely and supporting COO on all operational aspects and work in collaboration with him. ? Responsible for the SAR & Lead Discovery in his/her organization. ? Scientific responsibilities include managing the team of Lead Chemists and support and contribute to the success of the discovery work being done. ? Be an important part of the Scientific Team and help the organization as a part of the senior leadership to select targets . ? Supporting CEO?COO?CSO in his / her initiative in aligning the departmental business strategy with the over all DDDS strategy. ? Supporting the Site Head ? Chemistry CRO in building process chemistry capabilities in the organisation wherever necessary. ? Encouraging collaboration with computational and biology research groups to support a cohesive and build-in cross-functional scientific synergies for drug discovery process. ? Responsible for ensuring delivery time-lines and adherence to customer quality standards. ? Customer Relationship management. ? Collaborating with other Strategic Business Unit Heads in providing scientific knowledge and inputs supporting business growth. ? Partnering with HR in developing and building scientific competencies in the organization. ? Associating with CEO / CSO & Strategic Business Unit Heads in strategizing the drug discovery business and other businesses for the organization. ? Responsible for optimal utilization of resources in his/her organization. ? Responsible for driving career advancement plans, objective / goal setting, deciding on the Goals & Objectives for direct reports and ensuring a similar approach for down the line reporting in the organization. ? Revenue and budget management. ? Supporting implementation of various HR policies and procedures as published from time to time to ensure smooth functioning of the operations.

ISIS Base

Senior Software Engineer

Molecular connections, a leader in the field of Informatics with head office in Bangalore, India and offices globally has positions available Senior Software Engineers. The right candidate will be given opportunity to work on cutting edge projects and products, to work with best in-class team and globally renowned customers. Candidates with experience in the following domains can contact us : Job Description A Senior Software Development Engineer who will provide both technical leadership and hands-on software development in delivering content to online services. Other duties include participation in and influencing the evolvement of existing software and data architecture. Required Skills * Bachelors degree in computer science and/or computer engineering * Minimum of 3 years of software development experience in a Unix/Linux, MacOS and/or Windows computing environment. * Strong technical aptitude and proven technical leaderships skills o Hands-on development experience with XQuery and XML server technology o Hands-on development experience with Java Server Faces, Dojo Ajax Tool kits, WUI & server technology o Working knowledge of W3C XML initiatives + Experience with Altova?s XML tools (XMLSPY & MapForce) + Working knowledge of JEE & Java + Strong analysis skills and attention to detail + Strong teaming and interpersonal skills Desired Skills & Experience: * Knowledge of Mobile Application Development o Objective-C o Cocoa Touch o Xcode o Interface Builder o iPhone SDK * Knowledge of Project Management practices * Knowledge of Chemistry * Exposure to large scale data processing using Mapreduce, Apache Lucene & Eclipse Rich Client Platform (RCP)

Postdoctoral Research Associate

A postdoctoral research associate position is available on the molecular design of peptide-based biomaterials. A successful candidate should have extensive experience in biostatistics or bioinformatics. Research experience in QSPR/QSAR is highly desirable. Apply before 12/31/09. Use "Biostatistics" in your e-mail subject line.

Postdoctoral positions available

We are seeking PhDs in chemistry or PhDs in biological sciences for a number of start-up postdoc positions. This is a great career opportunity for a scientist at start of his/her career

Senior Drug Discovery Applications Scientist

Senior Drug Discovery Applications Scientist I am assisting to recruit a Senior Drug Discovery Applications Scientist for a client with in New York. This client is recognized as a high-growth leader in the development and delivery computational methods for drug discovery and development. This company offers excellent compensation and generous benefits. Here is more information: They are seeking a scientist for their Drug Discovery Applications Group. The successful candidate will become part of a multidisciplinary drug discovery team working on both in-house efforts to improve and apply drug discovery methodologies and on collaborative projects with pharmaceutical/biotechnology partners. Job Description: Actively participate in Drug Discovery Applications Group projects Apply drug discovery software and perform analysis of the results Effectively communicate results to other members of the Group Work closely with the Development Team to test and improve Drug Discovery technologies Essential Qualifications and Experience: Ph.D. in computational chemistry, organic chemistry, or biochemistry Computational experience in at least 1 of the following areas: molecular modeling, structure-based drug design, virtual ligand screening, computationally-driven lead optimization, ligand-based design, or homology modeling Excellent verbal and written communication skills Ability to work independently Desirable Skills: Programming skills: Perl script writing, in particular. Experience with chemical databases Benefits include: Medical, Dental, 401K, Flexible Spending Account, 3+ weeks vacation and tuition reimbursement. -your resume in word or text format -your salary requirement It is important to use the position title as the subject of your email to enable your resume to reach me as quickly as possible. If you aren't interested or feel you are not qualified, do you know anyone who would be interested? We do offer generous referral fees. Thanks for your time and have a great day!

CHEMIST

QUALITY CONTROL

CHEMIST

QUALITY CONTROL

Sr. Director

This is a great opportunity to work with cutting edge, structured based drug design. All of the technologies developed by this company are state-of-the-art & they are a recognized leader in their field. They are looking for a medicinal, organic chemist at the MS of BS level to participate in their drug discovery efforts. The position offers a lot of variety & challenge with responsibilities ranging from designing novel compounds to developing SAR profiles to lead identification & more.

Scientist: Protein Purification Specialist

Scientist: Protein Purification Specialist (JO 1021-MP) We are seeking a PhD or MS level Scientist with strong recombinant Protein Purification experience. This person must have expertise in protein purification under cGMP guidelines; s/he will lead the execution of varying purification protocols within a cGMP facility. Existing facility expanding to include a 2nd suite to run more than one campaign at the same time. Successful candidate will have a Ph.D., will have hands-on experience: ? With various forms of chromatography (affinity, exchange, HIC, ion, etc) ? Centrifugation and ? Tangential Flow Filtration/TFF, DiaFiltration/DF and/or UltraFiltration/UF ? Worked in cGMP environment. In addition, experience with aseptic techniques useful particularly in the areas of eukaryotic cell culture and viral propagation. Candidate must previous supervisory skills. Also, candidates must have strong written and verbal communication skills. Education: PhD with ~ 2yrs preferably in Pharma/Biotech/Animal Health industries; will consider core facility experience. or MS with ~4 yrs preferably in Pharma/Biotech/Animal Health industries; will consider core facility experience. If you have an interest in this or other opportunities, please send your resume as a MS Word compatible file attached to email to the attention of Basirah at RS&A. All correspondence is held in strict confidence. -------------------------------------------------------------------------------- (Ms) Basirah Al'Basit/Ann Rathbun RS&A ~ Scientific Search Sedona, AZ 86341 USA TEL: (928) 203-0074 EM: RSA@sedona.net

Chemist

Explore the Possibilities! Headway LifeScience Resources seeking Chemists for well respected testing facility located in Irvine. Competitive compensation offered! This organization is a testing facility providing analytical-through-formulation support for many of the nation's leading pharmaceutical, biotechnology and medical device companies. In response to the growing needs of their customers, they have recently expanded their breadth of services and depth of expertise in pharmaceutical development to ensure support through preclinical, clinical, registration and commercialization. They offer an array of enriching career opportunities and are committed to the continual expansion of their capabilities, capacity and expertise to meet the growing needs of their customers ? and seek team members who can fulfill their mission of elite scientific leadership and exceptional client care. Successful candidates will have hands on experience using analytical instrumentation including HPLC, LC/MS, ELISA, CE, Gel Electrophoresis, and PCR. Experience with Biopharmaceutical analysis, analytical method development and validation for proteins and peptides, as well as dosage form design, including lyophilized and non-lyophilized inject able dosage forms, and capsule and tablet dosage form is highly desirable. Extractables/Leachables: Specializing in HPLC-UV-MS (APCI, electrospray, static FAB, probe EI) and GC-MS (EI, CI, headspace) characterization, method development and validation for pharmaceuticals as well as release testing. Specialized emphasis on packaging extractables/leachables characterization in primary and secondary packaging as well as metered dose inhaler (MDI) and dry powder inhaler (DPI) componentry. Validation of methodology to control additives in these materials/components and as leachables in drug products. Experience with impurity, metabolite, stability and degradant testing (characterization and quantitation) for drug product formulations (inhaled, parenteral and nasal dosage forms). Formulation: Design and conduct appropriate experiments. Measure solubility and evaluate solution and solid-state stability. Identify and select appropriate compositions to support Safety and clinical trials. Should have knowledge of analytical instruments (i.e., HPLC, TGA or DSC). Prepares standard and sample solutions. Maintains appropriate documentation (records and lab notebooks) as required by SOP's. Good understanding of USP and other compendial procedures and requirements is necessary. Requirements: B.S. in Chemistry, Biochemistry or related field with a minimum of 3 to 8+ years of experience in pharmaceutical industries. Strong analytical chemistry background is essential. How to Apply: E-mail resume to Mbhardwaj@headwaycorp.com or call Megha at (949) 260-9433. EEO/AA/M/F/V/D

R&D department

Working onthe process development of Compounds ,New molecule discoveries,

Medicinal chemistry

� Three years Six months of experience in total Organic synthesis. � Handling reactions from mg scale to kg scale. � Well versed with most modern analytical instrumentation and expertise in characterizing organic molecules using IR, NMR and MASS. � Well acquainted with purification techniques (Recrystallisation and column chromatography). � Experience in the operation of distillations. � Well experienced in handling sensitive reagents and reactions. � Capable of collaborative and independent work

Senior Chemist

Information Ventures, Inc. is seeking a Project Director/Ph.D. Senior Chemist. This individual will direct and manage a project to: (1) review and evaluate product chemistry and residue chemistry data on pesticides, including chemistry and metabolism of pesticides in plants and animals and resulting dietary exposure; and (2) prepare EPA Data Evaluation Records. The successful candidate will have 10 or more years of relevant experience that includes managing projects of major significance, reviewing and evaluating pesticide chemistry data, and scientific writing. This position requires familiarity with federal data requirements for pesticide registration, product properties test guidelines, and residue chemistry test guidelines. For consideration, submit cover letter, r�sum�, and salary requirements by fax (215-569-2575) or e-mail (jobs@infoventures.com). All information furnished must be in writing and must contain sufficient detail to allow us to determine if you can meet the above requirements. EOE.

Computational Chemist - Discovery R&D

The Discovery Chemistry Group within Dow AgroSciences is seeking a Computational Chemist who can successfully work as part of a multidisciplinary team to discover and exploit small molecule leads for crop protection, pest and vegetation management. Responsibilities will include: Generate various models (homology, QSAR, COMFA, etc.) to help direct targeted synthesis. Generate 3D minimizations, matching overlays, pharmacophore models, and pharmacophore searching of 3D databases to aid targeted synthesis and acquisition. Participate in the generation and exploration of ideas using cheminformatics tools. Conduct simulation of ligands docked in protein models to influence target selection. Leverage capabilities and technical knowledge to impact and enable a wide range of Discovery science efforts including process improvements, diversity assessment of chemical collections, etc. Evaluate, recommend, and implement state of the art computational capabilities for Discovery Chemistry. Generate predictive models for physical property calculations. Develop and maintain a variety of databases related to the needs of different project teams. Coach chemists and biologists in the use of computational and cheminformatics tools for lead generation and optimization. Qualifications: Ph.D. in Computational Chemistry is required. Post-doctoral and/or industrial experience (1-5 years) in modeling is preferred. Research experience in one or more of the following areas is essential: structure-based design, pharmacophore modeling, QSAR, 3D database searching, combinatorial library design, and lead optimization. Familiarity with modeling software, such as Sybyl, Insight, Cerius2, Catalyst, Unity, MM3, MOPAC, and Gaussian within a UNIX environment is required. A track record of technical excellence, highly effective communication, teamwork, interpersonal skills, and demonstrated leadership is essential for success. Candidates must apply online at www.dowagro.com/careers (job number 803165) to be considered.

Senior Research Scientist; Food Flavor Chemistry

This position is responsible for the development of new, innovative products, from concept to final production that meets the customer needs as well as accomplishes the objective of profitability and efficiency. Activities include product development, small scale pilot plant testing, scale-up production at a USDA inspected and/or non-USDA research facility and finally involvement with full scale production at a processing plant. Additional responsibilities includesearching and evaluating new raw materials, creating new flavors for human and pet foods, researching basic flavor interactions among foods, ingredients and other flavor ingredients, integrating different technologies for better product performances. Activities also involve interaction with customers and ingredient suppliers, as well as various departments including Production, Accounting, and Sales/Marketing. The Senior Food Technologist is also expected to study existing resources and processes to identify cost reductions and quality improvement opportunities, and make periodic recommendations to management through reports, meetings, and presentations. Other duties may include reviewing incoming project requests and prioritizing/assigning to appropriate technicians, and supporting other special projects as needed. QUALIFICATIONS: Education: Preferred BS, MS, or Ph.D. in Food/Meat Science with study emphasis in flavor chemistry, reaction flavor, meat flavor, and/or meat protein based application. Experience: Minimum 5 years work experience in Research and Development while with Tyson or previous similar experience with another company. Work experience in a related area (QA, Lab, R&D non-protein, etc.) will be considered and receive some value. Research done while completing an MS or Ph.D. may be counted as part of this requirement. Computer Skills: Requires computer skills. For example, generating business letters, spreadsheets, and creating simple queries. May require knowledge of Tyson Business Computer System. Travel: 12 or more trips per year.

Senior Research Scientist; Protein Chemistry

This position is responsible for the development of new, innovative products, from concept to final production that meets the customer needs as well as accomplishes the objective of profitability and efficiency. Activities include product development, small scale pilot plant testing, scale-up production at a USDA inspected and/or non-USDA research facility and finally involvement with full scale production at a processing plant. Additional responsibilities includesearching and evaluating new raw materials, creating new products for markets that include Nutraceutical, Pharmaceutical, Cosmetic and Industrial arenas, researching nutritional and functional properties among ingredients and process conditions, integrating different technologies for better product performances. Activities also involve interaction with customers and ingredient suppliers, as well as various departments including Engineering, Production, Accounting, and Sales/Marketing. The Senior Food Technologist is also expected to study existing resources and processes to identify cost reductions and quality improvement opportunities, and make periodic recommendations to management through reports, meetings,and presentations. Other duties may include reviewing incoming project requests and prioritizing/assigning to appropriate technicians, and supporting other special projects as needed. QUALIFICATIONS: Education: Preferred BS, MS, or Ph.D.in Food/Meat Science with study emphasis in protein foods or Biochemistry. Experience: Minimum 5 years work experience in Research and Development pertaining protein chemistry while with Tyson or previous similar experience with another company. Work experience in a related area (QA, Lab, R&D non-protein, etc.) will be considered and receive some value. Research done while completing an MS or Ph.D. may be counted as part of this requirement. Computer Skills: Requires computer skills. For example, generating business letters, spreadsheets, and creating simple queries. May require knowledge of Tyson Business Computer System. Travel: 12 or more trips per year.

Senior Research Scientist; Pet Foods

This position is responsible for the development of new, innovative products, from concept to final production that meets the customer needs as well as accomplishes the objective of profitability and efficiency. Activities include product development, small scale pilot plant testing, scale-up production at a USDA inspected and/or non-USDA research facility and finally involvement with full scale production at a processing plant. Additional responsibilities includesearching and evaluating new raw materials, creating new pet foods and pet treats, researching nutritional, flavor and texture interactions among ingredients and process conditions, integrating different technologies for better product performances. Activities also involve interaction with customers and ingredient suppliers, as well as various departments including Engineering, Production, Accounting, and Sales/Marketing. The Senior Food Technologist is also expected to study existing resources and processes to identify cost reductions and quality improvement opportunities, and make periodic recommendations to management through reports, meetings, and presentations. Other duties may include reviewing incomingproject requests and prioritizing/assigning to appropriate technicians, and supporting other special projects as needed. QUALIFICATIONS: Education: Preferred BS, MS, or Ph.D. in Food/Meat Science with study emphasis in pet food nutrition,formulation, protein chemistry, and/or meat protein based application. Experience: Minimum 5 years work experience in Research and Development pertaining to pet foods while with Tyson or previous similar experience with another company. Work experience in a related area (QA, Lab, R &D non-protein, etc.) will be considered and receive some value. Research done while completing an MS or Ph.D. may be counted as part of this requirement. Computer Skills: Requires computer skills. For example, generating business letters, spreadsheets, and creating simple queries. May require knowledge of Tyson Business Computer System. Travel: 12 or more trips per year.

Senior Research Scientist; Pet Foods

This position is responsible for the development of new, innovative products, from concept to final production that meets the customer needs as well as accomplishes the objective of profitability and efficiency. Activities include product development, small scale pilot plant testing, scale-up production at a USDA inspected and/or non-USDA research facility and finally involvement with full scale production at a processing plant. Additional responsibilities includesearching and evaluating new raw materials, creating new pet foods and pet treats, researching nutritional, flavor and texture interactions among ingredients and process conditions, integrating different technologies for better product performances. Activities also involve interaction with customers and ingredient suppliers, as well as various departments including Engineering, Production, Accounting, and Sales/Marketing. The Senior Food Technologist is also expected to study existing resources and processes to identify cost reductions and quality improvement opportunities, and make periodic recommendations to management through reports, meetings, and presentations. Other duties may include reviewing incomingproject requests and prioritizing/assigning to appropriate technicians, and supporting other special projects as needed. QUALIFICATIONS: Education: Preferred BS, MS, or Ph.D. in Food/Meat Science with study emphasis in pet food nutrition,formulation, protein chemistry, and/or meat protein based application. Experience: Minimum 5 years work experience in Research and Development pertaining to pet foods while with Tyson or previous similar experience with another company. Work experience in a related area (QA, Lab, R &D non-protein, etc.) will be considered and receive some value. Research done while completing an MS or Ph.D. may be counted as part of this requirement. Computer Skills: Requires computer skills. For example, generating business letters, spreadsheets, and creating simple queries. May require knowledge of Tyson Business Computer System. Travel: 12 or more trips per year.

quality control

control tthe quality of products of cocacola

Associate Director- Medicinal Chemistry

Roles & Responsibilities: ? Work on the discovery of novel treatments for various therapeutic areas. ? Responsible for all medicinal chemistry activities in Lead Optimization and Lead Identification projects. ? Manage a group of 14 chemists and responsible for local Compound Management Group. Skill Sets: ? Candidate should have minimum of 10 and maximum of 20 years of Experience in Medicinal chemistry. ? Must be a PhD in medicinal Chemistry or PhD in Chemistry but expertise in Medicinal Chemistry. ? He should have experience in : a) Therapeutics Targets b) Responsible in new chemical Entities and therapeutic Indications. c) Optimization of Hits. d) Managing of Moral compounds. e) Some knowledge in IP. f) Team Management (handling a team of Chemists) g) Hands on Experience in Organic Synthesis. h) Exposure to Pre clinical Studies.

Director - Process Chemistry

Contract QA person

QA tester/ Programming knowledge and experience with high level degree in Organic chemistry CONTRACT POSITION

Associate Director - Analytical Chemistry

Job Profile: ?Should assist in the recruitment of appropriate personnel to ensure the building of a high performance group that would be capable of attracting the best available talent. ? Managing, developing and training a multi-project team/section of Process Chemists, Analysts or Engineers, in accord with the principles of MITP. He will be responsible for setting the objectives of his reportees and their performance evaluation through halfyearly and annual appraisals. The role holder will typically have 2-3 reports at Band 3 level who manage their own teams. ? Planning and monitoring the work of their team/section, and optimally deploying resources, to deliver the Functional contribution to projects. May need to shuffle resources as per requirement. Should ensure that resource utilization is captured in a uniform monthly format. ? Accountable for the overall technical direction of each of their teams? work across several projects, and for identifying key innovations that will enhance the efficacy of development processes. Should build up chemistry capability of the group to match those at other sites. ? Ensuring that their own work and that of their team is performed in accordance with SHE and GMP requirements. ? Authorising expenditure and recommending the purchase of starting materials, instruments and equipment required by the team. ? Making a personal scientific contribution to the solutions of technical problems across project boundaries. Presenting work to enhance the sharing of technical information and the external image of PR&D. Should make scientific presentations to the group to enhance scientific knowledge. ? Possibly representing their Function on the PR&D Core Project Team and being responsible for implementation of decisions taken. ? Delivering documentation required to support the development and registration of new products, agreeing analytical specifications, producing and approving contributions for regulatory dossier submissions. ? Contributing to the overall management and development of their Function and Global PR&D, and taking a lead role in management activities within their Function on behalf of the Head of Function. Contributing significantly to the development of strategy within their Function. ? Possibly acting as deputy to the Head of Function. ? Making a significant contribution to strategic improvement projects, either within Global PR&D or spanning GPR&D and key interface departments, for example by representing their function or GPR&D on improvement teams. ? Working and communicating effectively across Departmental boundaries, often taking responsibility for projects that span across different functions within Company. For example, making use of experience and business knowledge to facilitate the transfer of projects from Discovery Chemistry to GPR&D, or from GPR&D to Operations.

Scientific Manager - Computational Chemistry

3-8 years of industry experience in the application of computational chemistry in drug discovery. The candidate should have hands on experience with using commercial software for molecular modeling with different biological targets. Desired Skills and Expertise: Computer Aided drug designing. Molecular Modeling Technology and Structure Analysis. Combinatorial Library generation, Virtual Screening. Experience with structure-based design, docking and chemo informatics. The candidate should have excellent communication skills to work with a multi-disciplinary team of scientists and to interact with global clients.

Associate Scientist: Protein Assays

Kelly Scientific Resources currently has an outstanding contract opportunity for an Associate Scientist located in the heart of Research Triangle Park with a global chemical company specializing in agricultural products. This position will require several years of industry experience in Biochemistry and Molecular Biology techniques. This is a temporary assignment that will last through 12/31/2009. Job Duties: - Protein expression and purification - Perform various immunoassays and optimization of techniques - Protein quantification - Conduct enzymatic studies - Correctly handle field samples and provide accurate documentation - Strong computer skills and database management

Medicinal Chemist

Job Responsibilities: We are hiring at all levels, from principal investigator to scientist. Masters to Ph.D.s Proposes, designs and conducts applications and solutions to experimental problems with minimal supervision. Carries out hands-on synthesis, purification and characterization of milligram to multigram quantities of compounds. Education: MS in Chemistry with 5 or more years of industrial experience Technical Competencies: - Broad range of chemistry experience including independent design and implementation of chemistries and transformations - Experience in the synthesis of pharmaceutically relevant compounds - Milligram to multigram scale experience - Experience in scale-up and physical chemical analysis of small therapeutics, especially NMR, IR, MS, LC, etc - Track record of independent technical problem solving - cGMP experience a plus Work Habits: Self motivated, Team player, open, quick learner with a passion to succeed Track Record: Patents and/or publications in peer reviewed journals

Chemo-informatics, ISIS Base

QC Lab Technician

Chemical company looking for Qualilty Lab Tech with ICP or HPLC and multiple particle sizing. Physical testing: pH, viscosity,specific gravity. SPC and SQC and control charting techniques. Great opportunity for fresh grad or entry level experience. Must have BS degree, chemisty or biology.

Postdoctoral Research Associate

Senior Computational Chemist

We seek a Senior Computational Chemist to join our Drug Discovery team. The successful candidate will have recognized expertise and demonstrated success in the utilization of computational techniques to aid in the discovery and optimization of drug candidates, and will be expected to have a close familiarity with commercially available computer-assisted drug design applications. The Senior Computational Chemist will also use proprietary computational applications to provide pharmacophore, homology, QSAR, and other models to assist in the rational design, selection and optimization of leads. Experience in obtaining and manipulating crystallographic data, iterative structure- and activity-guided lead optimization, three-dimensional pharmacophore prediction, informatics, ligand docking methodology, ADME/Tox and pharmaceutical parameter prediction, quantum mechanical calculations, and statistical mechanical calculations is required. It is essential that the Senior Computational Scientist have a firm understanding of the precepts of organic and medicinal chemistry and the ability to communicate freely and work closely with Snowdon medicinal chemists and biologists as well as management. The successful candidate will have a PhD in computational chemistry, physical chemistry, or a closely related discipline and will have accumulated between 5 and 10 years experience in an industrial organization. We seek highly motivated scientists with exceptional communication and presentation skills, who can excel in a highly goal-oriented entrepreneurial atmosphere.

Lecturer / Professor/BEd. Teachers

Lecturer / Professor/BEd. Teachers Professionals are in great demand in Canada and Australia.WWICS has a vast experience in processing the cases of Lecturer / Professor /BEd. Teachers Professionals for Immigration and Settlement in Canada, Australia and Denmark. WWICS is world leader in providing Global Resettlement Solutions and we offer customized solutions in various streams of Immigration, Placement and Settlement like: ? Permanent Residency For Skilled Workers. ? Permanent Residency with Arranged Employment. ? Global Business Ventures for Investors, Entrepreneurs and Self Employed ? Provincial Nominee Programs or Business Persons & Farmers ? Student Visa ? Family Class sponsorship visa ? Visitor visa ? Post immigration services (placement & settlement) ? Judicial appeals and ? Edu-Skilled category. ? All kinds of immigration matter Hurry! Canada has introduced a new processing system where in the applications will be processed on a very fast track and the applicant would obtain Permanent Residency within 6 to 12 months. Besides this, Australia and Denmark too offer lucrative opportunities and have improvised their immigration system . So what are you waiting for. You may never get this golden opportunity again, retain our services today & start your Immigration Process for faster settlement in your preferred country.

Scientific Manager/ Senior Scientific Manager

Role : Responsible to perform multi-step synthesis in Medicinal chemistry lead optimization. Skill Set: Strong competency in the synthetic organic / Medicinal chemistry; Experience in a variety of synthetic methods, especially in heterocyclic chemistry would be an added advantage; Experience of performing multi-step synthesis in Med. Chem. lead optimization, full understanding of mechanistic details, scale-up and/ or process chemistry; Ability to work in a multidisciplinary, highly team-oriented environment that includes medicinal and process chemists and biologists; Ideal candidates must have demonstrated abilities in taking initiative, work independently, problem solving, team work and communication skills; Experience in working with a drug discovery environment with an appreciation of Medicinal Chemistry is desirable.

production

Dear Sir, I wish to introduce my self as M.Sridharan postgraduate in Chemistry. I am presently working in Biocon -junior excutive-custom synthesis pilot plant (R&D) -bangalore. As i have one year working experiance in Aqua fresh mineral water company-chennai lab-chemist- quality controller. I am very much interest to work in your company. I kindly request you to give me an opportunity in your Company. So that i can prove my mettle and expertise to your fullest satisfaction. Kindly give need full. I am here with enclosed my CV for your kind perusal. Thanking You Yours truly, M.Sridharan.

Scientific Manager-ElectrophysiologyIon-channel

The requirement is with one of our renowned client-Biotech/Pharma company based out of Bangalore, India location. The company is a contract research organization (CRO) dealing with several projects across the globe is looking for Sr. Scientist professionals who are working on Electrophysiology, ion-channel research. Position: Scientific Manager ? Electrophysiology(Ion-channel) Essential: PhD degree in Biophysics/Pharmacology/Biology with minimum 3 years of experience in ion-channel research Preferred: Post-doctoral training in the US/Europe in electrophysiology for 2-3 years Job description In this role, the person will have the responsibility of building and leading a team of scientists to support projects ranging from early to late-stage discovery. The candidate should have first-hand experience in patch-clamp methodology and cell culture as well as knowledge in general lab procedures. Experience in recordings with tissue slices will be an advantage. Familiarity with the operation of common laboratory instruments and knowledge of software commonly used for electrophysiological experiments is required. The successful candidate should demonstrate the ability to organize and present data, have strong written and oral communication skills, and hold a track record of excellent performance in a team-oriented environment. Prior job experience in a biotech or pharmaceutical company is beneficial but not required. Experience with automated patch-clamp system will be an added qualification. Location: Bangalore, Karnataka, India. Incase if you are looking for change please do reply back with your immediate contact number, so that I can update you regarding the same. Revert me back with your updated profile.

Assis. Prof. Medicinal chemistry

University work: teaching medicinal chemistry

Manager Commercial

Key Customers Internal Customers : All departments in CCPL and corporate Finance. External Customers: Banks, Governmental Officials (Excise), Customs, Sales Tax, Income Tax, Auditors (Statutory & Internal) Key Responsibilities 1. Maintain regular effective communication with customers on daily dispatches, Air & Sea Shipments. 2. Co-ordinate with clearing & forwarding agents, customs for errorfree timely logistics compliance. 3. Complete DEPB regular documentation. 4. Ensure timely renewals of customs, octroi, & other relevant government permission / approval for smooth working of export function. 5. Implement systems & monitor activities of purchase for cost effectiveness & quality improvement. 6. Implement JIT concept in Raw material & vendored our item with plan to achieve targeted cost reduction. 7. Maintain good co-ordial relation with excise , customs Income tax and related departments. 8. Communication & keep update for related rules & regulatory requirements through consultants for sales tax, excise import, export income tax etc. 9. Co-ordinate with corporate finances & auditors for regular audits and timely completion of balance sheet. 10. Arrange return of rejected materials within scheduled time. 11. Dispose scrap material of the plant inviting tenders and with the approval of the directors 12. Arrange container for export consignment. 13. Provide feedback to superior on issues affecting the companies performances in the area of purchase, import export.

Q.A./Q.C Manager

1. Responsibility 2. Ensure compliance to FDA ,CGMP,ISO 9001:2000 & HACCP Systems through periodic audits 3. Ensure continual quality improvement. 4. Ensure up gradation of product quality to world class status. 5. Ensure redressal of customer complaints in a timely manner & develop and adopt appropriate solutions to prevent recurrence and occurrence of similar problems. 6. Ensure product compliance as per the specifications prior to dispatch to customers. 7. Train employees to increase awareness about quality. 8. Improve systems in order to reduce the gap between actual practice and documented procedures. Other responsibilities 1. Discharge the responsibilities of TPM Co-ordinator for implementation of all the steps recommended by JIPM under the guidance of Corporate QA. 2. Discharge all responsibilities relating to parenting of products. Key Activities Performed 1. Attend daily P & Q meetings and discuss daily quality issues to resolve them. 2. Conduct CA/ PA meetings to discuss and implement solutions & problems 3. Submit Reports to senior as required in the pre-determined time frames, viz. MPR reports , Quality reports etc. 4. Attend monthly HPMC Project & Joint Quality Meetings conducted by directors. 5. Conduct/ attend weekly TPM Progress Review Meetings. 6. Carry out need based training for statistics, HVAC,HPMC, etc. 7. Make aware and share information on various aspects of production, pin development, quality, etc with all persons of respective department. 8. Keep update on regulatory and statutory standards ?Domestic & International.

PURCHASE EXECUTIVE

Key Customers Production HOD, HPMC/QA HOD, Machine Projects HOD, Store Assistants,Accounts HOD, External Customers: Customs, DGFT-Commissioner , Octroi Department. Key Responsibilities 1. Development & Selection of Vendors on the merit of Quality , delivery and cost for components needed for the company for machines & equipments. 2. Liaison with regulatory authorities such as customs , excise for exports 3. To carry out MIS generation. 4. Alert supervisors on rules and regulations getting newly introduced which affects affects import, export. 5. Ensure compliance to FDA, cGMP,1SO 9001: 2000 & HACCP through periodic audits 6. Train subordinate to fill up the competency gap for the job. Key Activities 1. Receipt of indent from all departments of the company. 2. Floating enquires for domestic purchase and import. 3. Raising purchase orders & getting those signed by superiors who are authorized for approval of PO?s. 4. Follow up for supplies. 5. Prepare dispatch report for customer in co-ordination with production departments of the company. 6. Co-ordinate with clearing agents for exports of consignments, but selecting reliable and economical airlines , shipping lines. 7. co-ordinate with Mumbai Municipality for octroi matters for exports of consignments. 8. Arrange Form A for export consignments relevant to those countries who need it. 9. Apply for DEPB benefits and liaison with DGFT for availing the benefits well in time. 10. Co-ordinate with all departments and prepare annual budgets, develop and implement system for cost control through cost centre concept with budget as reference. 11. Annual goal setting based on priorities agreed with company head.

Project/ Design Manager

Qualification: B.E. Mech. Experience: 8 -12 years: Quality Assurance experience, preferred in Pharmaceutical Industry With Good knowledge of Autocad

Quality Assurance Manager

1. Attend daily P & Q meetings and discuss daily quality issues to resolve them. 2. Conduct CA/ PA meetings to discuss and implement solutions & problems 3. Submit Reports to senior as required in the pre-determined time frames, viz. MPR reports , Quality reports etc. 4. Attend monthly HPMC Project & Joint Quality Meetings conducted by directors. 5. Conduct/ attend weekly TPM Progress Review Meetings. 6. Carry out need based training for statistics, HVAC,HPMC, etc. 7. Make aware and share information on various aspects of production, pin development, quality, etc with all persons of respective department. 8. Keep update on regulatory and statutory standards ?Domestic & International.

Sr. Research Scientist DMPK

My client is in search of a laboratory-based leader of a bioanalytics team responsible for drug metabolism and pharmacokinetics studies in a dynamic small molecule-based drug discovery program providing support for multiple discovery projects. Responsibilities include study, design, and analysis and result interpretation for lead validation/optimization in ADME/PK, pharmacodynamics and toxicokinetics studies. Laboratory equipped with 7 contemporary LC/MS/MS systems. This position requires a Ph.D. in Pharmacology, Pharmaceutical Chemistry, Bioanalytical Chemistry or related discipline with 5+ years industry experience in PK and Bioanalytical Chemistry. Strong knowledge and educational background in ADME/PK and extensive hands-on experience with bioanalytical instrumentation (LC/MS/MS, HPLC, and NMR), method development, data analysis and interpretation. The successful candidate will possess strong oral and written communication skills. Experience in lab automation is preferred.

ANALYTICAL CHEMIST

Job profile : a)Assisting for Method validation for GC, HPLC methods as per Protocols. b)Qualification of Analytical Instruments-GC, HPLC,X-RD, Malvern Particle Size Analyzer. c)Instrument handled- GC: Shimadzu, PerkinElmer, Clarus,Chemito&Nucon,HPLC:Waters, Shimadzu 2010 series. PSD: Malvern Particle size analyzer, X-RD-Shimadzu 7000S. Auto Titrator-Metrohm d)Software played:- Empower,Class Vp,Lab solution/GC solution.Total Chrom,TurboChrom,Class LC10/GC10,Master Sizer 2000,Shimadzu 7000s. e)Protocol preparation and performance of Method transfer,Method verification for HPLC,GC,UV,&X-RD methods as per Protocols. f)Trouble Shooting and critical spares maintenance for X-RD,GC, Malvern PSD. g)Pharmacopeias Reference Standard as per USP,BP/EP analysis and maintenance as SOP. h)IRS/WRS preparation, analysis and maintenance.GC reference solvents & Column performance and documentation as per procedure. i)Computer System validation with Analytical instruments-GC,HPLC,UV,FT-IR,X-RD and particle size Analyser as per CFR 21 Part 11 Procedure. j)OJT for new comers and its documentation as per procedure. k)OOS for Raw materials and its documentations as per procedure. l)AMC for critical Analytical instruments as per STP. m)Preventive maintenance for critical instruments GC,HPLC and PSD-Analyzer. n)Backup, Restoration, Password Maintenance of an analytical systems & Computers. o)Spread Sheet Validation(Excel) for standard deviation & Relative standard deviation.

Research Chemist

Present Experience:- Company Name : Shasun Chemicals & Drugs Ltd., Date start : June?1997 Date end : Till Date Job Title : Officer_ Quality Control Job profile : a)Assisting for Method validation for GC, HPLC methods as per Protocols. b)Qualification of Analytical Instruments-GC, HPLC,X-RD, Malvern Particle Size Analyzer. c)Instrument handled- GC: Shimadzu, PerkinElmer, Clarus,Chemito&Nucon,HPLC:Waters, Shimadzu 2010 series. PSD: Malvern Particle size analyzer, X-RD-Shimadzu 7000S. Auto Titrator-Metrohm d)Software played:- Empower,Class Vp,Lab solution/GC solution. Total Chrom,TurboChrom,Class LC10/GC10,Master Sizer 2000,Shimadzu 7000s. e)Protocol preparation and performance of Method transfer,Method verification for HPLC,GC,UV,&X-RD methods as per Protocols. f)Trouble Shooting and critical spares maintenance for X-RD,GC, Malvern PSD. g)Pharmacopeias Reference Standard as per USP,BP/EP analysis and maintenance as SOP. h)IRS/WRS preparation, analysis and maintenance.GC reference solvents & Column performance and documentation as per procedure. i)Computer System validation with Analytical instruments-GC,HPLC,UV,FT-IR,X-RD and particle size Analyser as per CFR 21 Part 11 Procedure. j)OJT for new comers and its documentation as per procedure. k)OOS for Raw materials and its documentations as per procedure. l)AMC for critical Analytical instruments as per STP. m)Preventive maintenance for critical instruments GC,HPLC and PSD-Analyzer. n)Backup, Restoration, Password Maintenance of an analytical systems & Computers. o)Spread Sheet Validation(Excel) for standard deviation & Relative standard deviation.

Production Organic Chemist

TCI America, located in Portland, Oregon is a manufacturer & distributor of specialty organic chemicals to researchers in the pharmaceutical, bio-tech, and other related industries Summary of Job Duties of a Production Chemist: A. Performs established, standardized organic chemical experiments and R&D experiments according to batch record or assists method development of such experiments. B. Assists in implementing new testing and analytical methods involving either automated analytical systems or manual laboratory analytical procedures C. Completely and precisely record relevant information in laboratory notebooks and prepares analytical reports. D. Studies reports from similar projects to learn more about the chemical processes involved. E. Develops and suggests minor adaptations and fills in the gaps found in the newly developed guidelines that govern the new testing methods. F. Extends and modifies approaches, precedents, and methods to solve a variety of chemical problems with unprecedented and obscure aspects G. Solves problems and improves the methods and processes of organic synthesis, which often require the development, adaptation, and modification of precedents, methods, and procedures. H. Assist in conducting research on manufactured products to develop and improve products I. Coordinate & operationally supervise the operations of other production chemists assigned to production department to maximize efficiency. Necessary Knowledge, Skills and Abilities: A. Advanced degree in Chemistry with experience in organic synthesis. B. Knowledge in the interpretation of GC, HPLC, MS, and NMR sprectra C. Working knowledge of Microsoft Word, Excel, PowerPoint and Chemdraw D. Ability to multi-task & exercise independent judgment E . Previous management experience preferred TCI America offers competitive salaries, outstanding benefits to include employer paid health & dental insurance, 401(k) retirement plan with employer match as well as advancement opportunities.

Staff Scientist, polymer chemistry

Design and synthesize specific polymers and biomolecules having unique binding properties. Prepare and characterize polymer thin films, fibers and nanostructures. Work as part of a multidisciplinary team in the field of MEMS devices, sensors and nanomaterials. Skills should include strong synthetic skills, experience with DSC, TGA, DMA, FTIR, GC, HPLC. Experience with DNA/RNA synthesis and aptamers desired. This is a new company with significant growth potential

Staff Scientist, biochemistry

Bring a strong background in biochemistry, specifically the interations of DRN, RNA, PNA, Aptamers with large biomolecules, proteins, virus, bacteria, etc. Skill in sysnthesis and functionalization of biomolecules and strong background in analytical measurements, diagnostics, and related sciences. Work as part of a team developing new cutting edge MEMS and sensor products

junior chemist

junior chemist rfesher

PhD Position in Theoretical Chemistry

The research project aims at the development of computational schemes designed to treat molecular systems typified by strong non-dynamic electron correlation within the framework of density functional theory. Emphasis will be on the use of the ensemble approach within DFT, however an extension in the direction of density matrix functional theory will be considered as well. Specific goals of the project are: the development of fast orbital optimization algorithms, the calculation of response properties in strongly correlated electron systems, the development of a time-dependent formalism for calculating excited states. The computational schemes developed will be applied to various systems of practical importance ranging from organic biradicals and polyradicals to inorganic polynuclear compounds with complex magnetic behaviour. The project will benefit from a close cooperation with several theoretical groups located in the European Union and in the United States.

biochemistry

--------------

Assistant chemist

Job Title: ASSISTANT CHEMIST Location: Newport, IN Reference: 001923 Job Description: Job Duties: GC operator; will prepare and analyze DAAMS tubes (air monitoring samples) from arround the NECDF facility for the chemical agent VX using GC-FPD and GC-MSD methods of analysis.

Head of Chemistry

Dynamic, international pharmaceutical company. Based at their main R&D site in the South of France and reporting to the Head of Research, this key position will manage a rapidly expanding chemistry department (currently multicultural team of 25). In parallel, the successful candidate will be required to set up a small combinatorial chemistry unit at the USA R&D Site. There will be frequent interaction with the Group's R&D sites in the USA and Japan. The ideal candidate will a have a PhD in Chemistry, with at least 10-15 years post-doc industry experience - more specifically in medicinal chemistry from discovery through to development. Additionally: - hands on experience in parallel synthesis and combinatorial approaches within the discovery process for hit/lead finding and optimisation. - good knowledge of Biology (regulation of biochemical pathways, and rules governing ligand-receptor interactions ...) - "finger on the pulse" concerning new technologies/molecular modelling... - demonstrated management/leadership experience - ideally already having worked within a matrix organisation. - excellent communication and interpersonal skills. - fluency in French & English (or at least be willing to learn French if it is not the mother tongue).

Organic synthesis post-doctoral fellow

We are seeking a full time Post-doctoral Research Fellow to join our laboratory as soon as possible in pursuing lead optimization in anticancer drug discovery research. The position requires a PhD in organic chemistry and a strong background in the synthesis of small organic molecules. The position is for one year, with the opportunity for renewal if mutually desirable.

Sales Representative

A new position with an international biochemical company has just come available. The position is an Inside Sales Representative and the job details are below. Experienced and entry-level candidates with appropriate educational background are welcome to apply. If this position is not right for you, please feel free to forward it on to anyone you may know seeking a new opportunity. This full-time position will pay a starting base annual salary in the range of $35 - 50K plus individual performance bonus, team incentive pay and company-wide bonus program. The position is located in Torrance. A pre-employment drug testing and background screening is a required part of the hiring process. The company will be interviewing and hiring as soon as possible so please send your resume right away if you are interested. JOB FUNCTION: The Sales Representative (inside) will be responsible for selling the company's products and services by contacting prospective and established customers. The Sales Representative (inside) will follow up on leads and establish close customer contacts to promote the company's products to select accounts as designated by Sales Management. ESSENTIAL FUNCTIONS: Contact prospective customers to uncover sales leads and pursue to completion. Maintain sales program within assigned territory to meet Sales Budget. Sell company's products and services by calling prospective and established customers. Provide information to customers as it pertains to available services, prices and new products. Distill customer requirements and qualify project leads before presenting to operational functions. Present applicable company capabilities as benefits to prospective customers. Meet established company sales quota by obtaining and renewing orders. Monitor competitive activity and trends within the established territory. Prepare quotes or forward as required. Research marketing leads and follow-up. Act as liaison between customer contacts and operations personnel. ADDITIONAL RESPONSIBILITIES: Increase quote requests and sales. Gather and communicate relevant market information to Sales Management. Ensure that quotes are submitted in a timely manner. Follow up on customer concerns and requests for information and new customer opportunities. Reports to: Director, Product Services Department: Product Services REQUIREMENTS: Ideally, you will have a minimum 2 years + in customer service or sales and a minimum of a B.S. in science. Experience in pharmaceutical or fine chemical sales preferred. Excellent computer skills - Word, Excel, Access & Outlook, Access helpful. Excellent communication and phone skills. Positive presentation style. Motivation. Knowledge of company's products. Proactive. Aggressive/Competitive selling techniques. Strong prioritization and organizational skills.

Project Manager

Analytical Chemist

Responsible for sampling, testing and clearance of all the materials received in Instrument section. Responsible for testing and releasing results of all the in-process samples received from production, in Instrument section. ? Testing of raw materials, inprocess, intermediates and finished products by HPLC accurately without any deviations and delays. ? Calibration of HPLC?s, Analytical balances, pH meter as per the calibration schedules without delays. ? Planning of HPLC analysis to release the results right time as per the requirement. ? Reviewing of the analytical data and releasing the results right time to meet the dispatch requirements as per the planned scheduled.

Multiple Pharma Openings, Interview in Progress. Pl. Apply Immediately.

1) Vice President/ Manager : International Marketing/ Sales Location : Andheri (Mumbai) No. of Opening : 1 No. Qualification : Graduate in Chemistry with MBA in Marketing Experience : 5 to 8 years of experience in Bulk Drug International Marketing The candidate will be responsible for formulating and implementing sales strategies and defining business plans . __________________________________________________________________________ 2) Manager QA/QC Location : Tarapur (Near Mumbai) No. of Opening : 1 No. Qualification : M.Sc. / Ph.D ( Organic /Analytical chemistry .) Experience : 10 to 12 years experience in Bulk Drug industry __________________________________________________________________________ 3) Product Manager Location : Kandivali , Mumbai No. of Opening : 1 No Qualification : B.Pharm , MBA Experience : 2 to 4 years working as Product Manager / Executive ___________________________________________________________________________ 4) Product Executive /Officer Location : Kandivali , Mumbai No. of Opening : 1 No Qualification : B. Pharm, MBA Experience : 2 to 4 years working as Product Executive / Officer. __________________________________________________________________________ 5 ) Assistant Manager (Production) Location : Dombivli (Near Mumbai) No. of Opening : 1 No. Qualification : B.E.( Chemical) / M.Sc. (Chemistry ) Experience : 10 years of experience in Production in bulk drug industry . __________________________________________________________________________ 6 ) Asst. Manager ( R. & D.) Location : Dombivli (Near Mumbai) No. of Opening : 1 No. Qualification : M. Sc. Experience : 8 + years of experience in R.& D. Department of Pharma. Industry. __________________________________________________________________________ 7) International Marketing Executives Location : Andheri (Mumbai) No. of Opening : 2 Nos. The candidate will be responsible for International Marketing / Sales Qualification : Graduate in Chemistry with MBA in Marketing Experience : Experience : 0 to 3 years Bulk drug International Marketing will be preferred. __________________________________________________________________________ 8) Regulatory Officer Location : Andheri (Mumbai) No. of Openings : 2 Nos. The candidate will be supporting sales team Qualification : B.Pharm with MBA Experience :Experience : 0 to 3 years Prior Experience in International Bulk Drug Regulation will be preferred. ___________________________________________________________________________ 9) Materials Executive Location : Andheri (Mumbai) No. of Opening : 2 Nos. Qualification : B.E ( Chemical)/ Graduate in Chemistry with P.G. in Material Management Experience : 2 to 3 years. ______________________________________________________________________________ 10) Import / Export Executives ( Logistics ) Location : Andheri (Mumbai) Import : No. of Opening : 1 No. & Export : No. of Opening : 1 No. Qualification : Commerce Graduate , Computer Literate, Experience : 2 to 5 years experience in Logistics matters , Pre and post Shipment , L/C analysis, Export documentation , DGFT & Advance Licence and co-ordination with Manufacturing units _______________________________________________________________________________ 11) Export Executive/Assistant Location : Kandivali ( Mumbai ) No. of Opening : 1 No Qualification : Graduate Experience : 2 to 5 years in Export Documentation , DGFT and Advance Licence , Pre and post Shipment , DGFT & Advance Licence and co-ordination with Manufacturing units _______________________________________________________________________________________ 12) Information Scientist Location : Andheri (Mumbai) No. of Opening : 2 Nos. Qualification : M.Sc , Ph.D. (Chemistry) Experience : Minimum 2 + years in Pharma Industry. ______________________________________________________________________________ 13 ) MD (Tech Team) Location : Andheri (Mumbai) No. of Opening : 1 No. Qualification : M.Tech. / M.E. (Chemical) Experience : Experience : 0 to 3 years Bulk Drug Experience will be preferred. ____________________________________________________________________________ 14 ) Sr. Executive- QA/QC Location : Tarapur (Near Mumbai) No. of Openings : 2 No. Qualification : M Sc Experience : 5 to 8 years Bulk Drug QA/QC Experience ______________________________________________________________________________ 15) Sr. Executive QC Location : Tarapur / Dombivali (Near Mumbai) No. of Openings : 2 No. Qualification : M.Sc Experience : 4 to 5 years of experience and knowledge of sophisticated instruments ____________________________________________________________________________ 16) Sr. Executive AMD Location : Dombivali (Near Mumbai) No. of Opening : 1 No. Qualification : M.Sc / B.Sc with Chemistry Experience : 5 to 8 years Location : Dombivali (Near Mumbai) ____________________________________________________________________________ 17) Associate AMD Location : Dombivali (Near Mumbai) No. of Openings : 3 No. Qualification : M.Sc or B.Sc with chemistry Experience : 2 to 5 years _____________________________________________________________________________ 19)) R & D Executive (Projects) Location : Dombivali (Near Mumbai) No. of Openings : 4 No. Qualification : M.Tech / B .Tech ( Chemical) Experience : 0 to 3 years Transferring R.& D. into production of Bulk Drugs. ______________________________________________________________________________ 19) R & D Associates Location : Dombivali (Near Mumbai) No. of Openings : 3 No. Qualification : M Sc. (Chemistry) Experience : 1 to 2 years experience of transferring R.& D. into production of Bulk Drugs. _______________________________________________________________________________ 20 ) Executive QC Location : Dombivali (Near Mumbai) No. of Opening : 1 No. Qualifation : M.Sc (Chemistry ) Experience : 4 to 6 years of experience in Bulk Drug QC _______________________________________________________________________________ 21) Manager - FINANCE Location : Andheri , Mumbai No. of Opening : 1 No. Qualification : CA / Cost accountant + MBA Finance He will be responsible for Financial Planning management accounting and Budgetary Control, Treasury and MIS and provide inputs on all strategic matters encompassing operations, productivity etc. Exposure to arrangement of term loan/equity fund from financial institutions, costing & budgeting, inventory control, working capital management etc. is essential. Age Group : 35 - 40 Experience : 6 to 10 years in a large organization., Pharma Industry background will be preferred. _______________________________________________________________________ 22) Officer Finance Location : Tarapur (Near Mumbai) No. of Opening : 1 No. Qualification : CA / ICWA Experience : 2 to 3 years experience Knowledge of excise is a must ________________________________________________________________________________ 23) Systems Executive Location : Andheri (Mumbai) No. of Opening : 1 No. Qualification : Graduate with Diploma in hardware /Software Experience : 2 to 4 years ______________________________________________________________________________ 24) Quality Control Officer / Chemist Location : Kandivali (Mumbai) No. Of openings : 2 No. Qualification : M.Sc./ B.Sc. Experience : He Should be 2-4 years exp. in similar field and having knowledge of : 1. Analysis of finished products (Tablets, caps, Injections) 2. Sophisticated instrument handling a) HPCL b) F.T.I.R. c) UV spectrophotometer 3. Calibration of all Q.C Instruments 4.Packing Materials : Foil, Carton _____________________________________________________________________________________________ 27) Trainee Stores Officer Location : Tarapur (Near Mumbai) No. of Opening : 1 No. Qualification : B.Sc. (Chemistry) Experience : 2 to 3 years experience in Pharma industry _______

Synthetic Process Chemist - Seeking Master Chemists for a leading company!

Great Opportunities for Master Chemists! Confidential Company is seeking a team of Synthetic Process Engineers to join their growing company. Company is a leading supplier of ketone proxides, metallic stearate and provides state-of-the-art customized synthesis and separation services to clients in the areas of medicinal chemistry,chemical development,cGMP synthesis,and advanced separation technology. Location: So. California. Must be willing to relocate. Local Candidates are preferred, however, relocation assistance will be provided for selected candidates. Compensation: Competitive Experience Required: M.S. Chemistry (major academic institution preferred) Academic projects should reflect a solid background in organic synthesis. The candidate will have several peer-reviewed publications describing doctoral and postdoctoral work Experience in natural product synthesis and heterocyclic chemistry is preferred but not required 4-6 years of solid industrial process bench experience, including small scale academic work to multi-Kg preps and cGMP Previous experience working adhesives or polymer chemistry Experience with statistical and process control techniques Experience working in an ISO 9001 environment Teamwork, independent problem solving skills, interpersonal skills, ability to work effectively in a multidisciplinary discovery team environment, and excellent verbal and written communication skills

Computational Scientists

We are looking for Computational Scientists to maintain and develop products in the area of computer-aided drug design in our Hyderabad office. Required skills A candidate applying for this position must have - * Ph.D. in Computational Chemistry, Biochemistry, or Biology. * Peer-reviewed publications in Computational Chemistry, Bioinformatics, Cheminformatics, or Computational Medicinal Chemistry. * Post-doctoral research and/or relevant experience in the commercial sector. * Strong applied-mathematics skills along with algorithm development and methodology development skills. * Strong programming skills in C and/or FORTRAN. * Experience in X/Motif and OpenGL programming. * Familiarity with C++, including STL and with Windows development environment. * Familiarity with UNIX and/or Linux development environments. * Excellent written and verbal English communication skills. Job description Successful candidate should be able to: * Extend and maintain large software packages (100,000-line-plus) and library codes. * Participate in scientific and algorithmic development, as well as software design and implementation of new applications. * Be able to independently complete projects in collaboration with an international team of scientists and software developers.

Sr Manager - A R and D

Should be conversant with analytical development, method validation, stability analysis, calibrations, preparation of STPs / specifications. Should be well conversant with HPLC ,GC, spectrophotometers

SCIENTIFIC MARKETING DIRECTOR

We are looking for a top-quality Scientific Marketing professional who would play a leading role in promoting our products and expanding our business directions. The required qualifications include Ph D in chemistry or closely related area, several years of work experience in a key drug discovery position in pharma industry, in-depth knowledge of physical organic chemistry, QSAR/cheminformatics and pharmacokinetics. Excellent leadership and public speaking skills, good scientific writing and organizational skills, the ability to quickly absorb new technical/scientific information and get things done in time are of essential importance. Responsibilities will include scientific representation of our company to the users, relating our products to practical problem solving in many different R & D areas, designing product marketing strategies, and developing strategic relationships. In particular, this involves identifying specific market niches, formulating practical product applications, identifying selling points, creating application notes and real-life case studies, designing web announcements and e-newsletters, planning marketing events, public speaking during scientific conferences and customer's site visits, and solving many related problems. A successful candidate should be able to demonstrate a good knowledge of our products and their practical application areas, describe possible business expansion directions, and propose a plan of practical steps. Relocation not required (work from home while being in close contact with Sales and Development), but you must reside in US or Canada, and be willing to travel on a frequent basis. Residence in CT, MA, NC, NJ, PA or other states rich of pharma R & D centers is preferable.

Research Potision in Computational Physics/Chemistry

An American bio-pharmaceutical company seeks out a qualified scientist for a Researcher position to work in the company's Research Branch in Moscow. The duties will involve development and numerical implementation of the state-of-the-art quantum-mechanical methods for very precise calculations of the properties of biologically related molecules and their interaction.Skills: (a) excellence in quantum mechanics; (b) good theoretical background and practice in numerical methods; (c) fluency in programming (Fortran); (d) ability to work in a group; (e) experience in quantum calculations of atomic and molecular properties and/or in distributed computation would be an advantage.Salary: starting from 600-1200$ per month, depending on qualification.Deadline: October 31, 2004 or until the position filled.Contacts: Applicants should send an application letter with a full CV, including names of two referees, a list of publications, description of research and experience, to cv@algodign.com

Life Sciences Research Scientist

The main functions of the position are in R&D (70%), sales, marketing and business development support (25%) and manufacturing support (5%).The candidate will be the principle investigator for the research and development of nanocrystals (quantum dots) and nanocrystal conjugates for biological applications. The candidate will lead new product development and coordinate with the CTO/sales/marketing to develop strategic technology plans for biotechnology applications. The candidate will be the lead contact for external collaborators working on biological applications and support partners' research and development efforts to ensure their success. Deep knowledge of conjugation chemistries and the ability to demonstrate viability of reagents/product for specific applications is necessary. Candidate will have the ability to create novel biological reagents and new conjugation schemes and develop new bioassays. Excellent problem solving skills, presentation skills and ability to interact with customers and business partners required. The ideal candidate will have a degree in biochemisty, molecular biology, cell biology, immunohistochemistry or other related degree. PhD is preferred but not required. Some travel to customer site and trade shows is required.

Research and Development Manager

ÃÂ· Contribute to the evaluation and development of new inquiries (i.e. cost and resource allocation) ÃÂ· Develops process research project plans in collaboration that incorporate small-scale manufacture with other staff (e.g. Business Development, Pilot Plant) ÃÂ· Collaborate with other R+D Managers in assigning resources (lab space, equipment and staff) to projectsÃÂ· Co-ordinate multi-functional project teams ÃÂ· Monitor project plans progress through tools such as regular status meetings, schedule reviews, Gantt Charts and facilitate resolution of outstanding issuesÃÂ· Lead in the management of staff through contributing to activities such as recruitment and performance management ÃÂ· Provide advice to staff in R+D project leadership roles ÃÂ· Fulfil point of contact role for clients on scientific matters related to projectÃÂ· Prepare final project reportsÃÂ· Participate in project evaluations through report review, analysis and coaching ÃÂ· Ensure safe and clean lab operations ÃÂ· Proven experience in project management ÃÂ· Advanced knowledge of synthetic organic and process chemistryÃÂ· Strong knowledge and experience with production capabilities in pilot plant and kilo lab environments under cGMPÃÂ· Understanding of analytical chemistry and regulatory affairs would be an asset ÃÂ· Knowledge and experience in operational leadership including resource management skills

RESEARCH CHEMIST

Requirements include a BS in Chemistry with five years of experience or a MS in Chemistry with three years of experience in the following areas: ion trap, mass spectrometry and gas chromatography. Chemical ionization and chemical demilitarization experience are preferred. This position also requires US citizenship and the ability to obtain a favorable National Agency Check. Requirements also include the ability to obtain as well as maintain Chemical Personnel Reliability Program Certification. Candidates must be able to work any shift in a 24/7 operation. Job Duties: GC-ITMS chemist will perform GC analyses using both quadrapole and ion trap mass spectrometry under EI and CI modes of ionization. Samples include process and waste samples from the Newport Chemical Agent Disposal Facility. Candidates must be able to work any shift in a 24/7 operation.

Chief - Clinical Trials

Capable of understanding, developing, leading all aspects of clinical trials and contract research business Ample experience of clinical trials - a minimum of 15 years professional experience and at least 5 years in a Clinical Trials / Contract Research organization

APPLICATIONS SCIENTIST

We are looking for Applications Scientist with the following qualifications: Ph D in chemistry related area, at least two years of R & D experience in pharma company, good knowledge of physical organic chemistry, pharmacokinetics and in vitro assays used in PK simulations, good scientific writing, verbal communication and public speaking skills, ability to work unsupervised, quickly absorb new technical and scientific information, willingness to travel. Responsibilities will include presenting our software products at customers' sites and trade shows, establishing and maintaining good working relationships with prospects and customers, providing technical and scientific support, helping the users to solve various practical problems using our software, creating product application notes and real-life case studies, generating new ideas about possible product applications and communicating them to Marketing and Development. A successful candidate should be able to demonstrate a good knowledge of our products and their practical application areas. Relocation not required (work from home while being in close contact with Sales and Development), but you must reside in US or Canada, and be willing to travel on a frequent basis. Residence in CT, MA, NC, NJ, PA or other states rich of pharma R & D centers is preferable.

Senior Chemist

BS in Chemistry or Biology, four years of analytical chemistry or environmental monitoring experience and three years of supervisory experience. Hands-on knowledge of air sampling and analysis, toxic/hazardous chemicals, gas chromatography, wet chemical analysis methods including EPA SW-846 or standard methods. Solid PC skills are required. . This position requires US citizenship and the ability to obtain a favorable National Agency Check. Requirements also include the ability to obtain as well as maintain Chemical Personnel Reliability Program Certification. Candidates must be able to work any shift in a 24/7 operation. Job Duties: The Analytical Supervisor of DAAMS Analysis provides technical and supervisory guidance to an analytical laboratory staff of approximately 20 individuals in the development and analysis of (air monitoring) DAAMS samples using GC-FPD and GC-MSD with multidimensional chromatography. The successful candidate will also serve as backup to the Analytical Manager for the Newport Chemical Agent Disposal Facility. Will also supervise chemical lab staff to ensure adherence to strict analytical protocols, and timely delivery of analyses and responses to monitoring requirements. Will train and certify staff and implement chemical hygiene policies. Will also monitor procurement, use and disposal of chemicals used in lab operations and interface with the client and government representatives as needed

Research Chemist

MS in Chemistry, 2 years of hands-on experience in analytical methods development using multi-stage mass spectrometry (MS-MS) coupled with liquid chromatography. Prior supervisory experience is required. Hands-on working knowledge of trace and ultra trace level analytical techniques for sample preparations and analysis is required. This position also requires US citizenship and the ability to obtain a favorable National Agency Check. Requirements also include the ability to obtain as well as maintain Chemical Personnel Reliability Program Certification. Candidates must be able to work any shift in a 24/7 operation. Job Duties: HPLC Chemist will perform HPLC-MS and Ion Chromatographic sample analysis to support process analysis of the newport Chemical Agent Disposal Facility destruction of nerve agent VX

Associate Chemist

BS degree in Chemistry or science related field or 5 years environmental monitoring experience can be substituted for degree requirement. Experience in air monitoring of chemical warfare substances preferred. Job Duties: The Monitoring Branch Team Lead (Supervisor Technical Services) will be responsible for leading the monitoring staff in support of neutralization of chemical agent; ensuring adherence to strict analytical and monitoring protocols; timely delivery of analyses and responses to monitoring requirements and ensuring that daily work activities are scheduled. The Sr. Process Chemist will be responsible for analytical methods development , sample preparation and analysis.

Senior Chemist

Requirements include a BS in Chemistry and a minimum of five years of hands-on experience in analytical methods development and trace analytical techniques for sample preparation and analysis. Hands-on experience with Ion Trap Mass Spectrometers coupled with either GC or HPLC separations is required. Job Duties: The Sr. Process Chemist will be responsible for analytical methods development , sample preparation and analysis.

Research Chemist

This position requires a Bachelors degree in Chemistry and three years of relevant experience. Job Duties: The General Chemist will be responsible for the characterization of organic hazardous waste using HPLC, GC and ion chromatography with various detectors including mass spectrometers. The successful candidate will develop and validate methods, prepare samples and analyze them according to valid methods.

bioinfomatician

Drug designing / protein modelling

Business Analyst - Life Science / Biotechnology

Person should be from the field of Life sciences or Bio Technology domain. Major responsibility of Business Analyst is to analyze requirements and develop functional design of a product. Functional design includes work flow and user interface design, as well as the business rules definition. In addition Business Analyst will be main contact person for information related to functional requirement of the system. And business analyst assists software developers, Technical Writer and Quality Control Engineers in understanding the system requirement of the products.

Scientific Application Developer

Main focus of the job is application software development in C+++, to develop computational chemistry (molecular modeling) applications, that will be built on the top of their existing development platform using C++, CORBA, client-server and JAVA technologies. Skills required: * C and C++ programming * Strong background in discrete mathematics and graph algorithms * Knowledge of computational geometry, numerical analysis * Knowledge or experience with databases * Unix and Linux application development skills Required educational background: * BSc or MSc in Computer Science, Computer Engineering or similar field * proven academic excellence either in university-level mathematics courses or university-level computer science courses Desirable: * University-level chemistry, structural biology or physics courses * Excellent written and verbal communication skills * Familiar with CORBA distributed technology Additional nice to have: * Experience in commercial software development * Experience in scientific programming, computational sciences or molecular modeling * Expertise in 3D graphics and graphical user interface design * Knowledge of bioinformatics or cheminformatics

Group Leader Medicinal Chemistry

Job Description Title: Group Leader-Medicinal Chemistry Reports to: Vice President, Chemistry Summary and Scope of Position: The Group Leader Medicinal Chemistry ensures the delivery of high quality drug development candidates within competitive timeframes and with optimal medicinal chemistry contributions at high scientific standards in all assigned drug discovery projects. The Group Leader Medicinal Chemistry effectively manages and leads the reporting medicinal chemistry group and develops the capabilities of the staff and the chemistry technology platform. Managerial Manage a medicinal chemistry group of up to 10 PhD level scientists and MSc or BA level research associates within ongoing hit to lead or lead optimization projects. Provide performance feedback, create and implement development plans for subordinates in collaboration with Vice President, Chemistry. Determine key requirements of subordinate positions and recruit and evaluate candidates for staff roles together with Vice President Chemistry and HR. Participate in the strategic planning and development of the Chemistry Department as a member of the Chemistry Management Team, to ensure the highest standard of the medicinal chemistry contribution to the projects. Coordinate medicinal and/or synthetic organic chemistry outsourcing activities or collaborations within assigned projects if relevant. Scientific Manage all medicinal chemistry activities in assigned projects ensuring the delivery of high quality development candidates within competitive timeframes. Resolve medicinal chemistry related patent issues within assigned projects, including developing and executing a strategy in close collaboration with Patent attorneys, to ensure optimal protection of medicinal chemistry related IPR. Coach and advise subordinates in medicinal, synthetic and organic chemistry issues to ensure high quality contribution to assigned projects. Participate in the development of the synthetic and analytical chemistry technology platform to ensure efficient synthesis, purification and analysis of single compounds, compound series and libraries. Ensure high quality communication of medicinal chemistry issues at the project team meetings and in reports. Ensure documentation of performed scientific work according to good scientific, practical and SNAP/LU guidelines. Ensure the group maintains the highest laboratory safety standards. Hold group members accountable for safety in their area. Ensure any lab modifications enhance safety. Ensure a strong network and visibility of Synaptic and Lundbeck in the medicinal and synthetic organic chemistry field by participation in scientific meetings and by developing and delivering high quality publications and presentations. Requirements Education PhD and PostDoc in synthetic organic chemistry required. Experience 10 years medicinal chemistry and drug discovery industrial experience is required. Experience with all phases of drug discovery from hit identification to delivery of development candidate, using state off the art (automated) parallel synthesis technologies also required. Track record of significant scientific contributions with publications in peer-reviewed journals and patents is essential.Experience effectively managing, supervising or leading other professionals strongly preferred. Medicinal chemistry experience with GPCRs in the CNS field, and a demonstrated track record of delivery of high quality drug development candidates preferred. Additionally, strong interpersonal and influencing skills, and comfort working in a changing environment is beneficial.

Production Chemist

1. Performs established, standardized organic chemical experiments and R&D experiments according to batch record or assists method development of such experiments. 2. Assists in implementing new testing and analytical methods involving either automated analytical systems or manual laboratory analytical procedures 3. Completely and precisely record relevant information in laboratory notebooks and prepares analytical reports. 4. Studies reports from similar projects to learn more about the chemical processes involved. 5. Develops and suggests minor adaptations and fills in the gaps found in the newly developed guidelines that govern the new testing methods. 6. Extends and modifies approaches, precedents, and methods to solve a variety of chemical problems with unprecedented and obscure aspects 7. Solves problems and improves the methods and processes of organic synthesis, which often require the development, adaptation, and modification of precedents, methods, and procedures. 8. Assist in conducting research on manufactured products to develop and improve products 9. Record equipment usage in equipment log books and clean production equipment. 10. Conducts development of process as needs dictate. 11. Assist in scale-up of projects as needed. 12. Confers with other chemists regarding research, and prepares technical papers and reports. 13. Practice good laboratory housekeeping, both of own bench and desk and common areas.

SENIOR SCIENTIST

SENIOR SCIENTIST PARAMUS, NJ�?·MUST HAVE HTS AND GPCR and CNS�?·Design assays for library screening to support our clientâ¤�?s drug discovery pipeline.�?·Optimize and run functional assays for G protein-coupled receptors.�?·Collaborate with leading scientists in cell biology to ensure robust protein expression from cell lines.�?·Work with a team of chemists to advance specific drug discovery projects.�?·Provide expert user knowledge in the design of a future state of the art HTS facility.PhD in molecular pharmacology or biochemistry with focus on GPCR biology.2-5 years industrial experience in drug discovery, preferably within the field of GPCRs and CNS biology.Detailed knowledge of one or more of the following:GPCR pharmacology/signal transduction, radioligand binding assays, cell-based assays, automation, expression systems for membrane proteins, fluorescence-based measurements (FLIPR.)Experience with effectively working with other professionals, especially in a collaborative culture.Strong interp

Post-doc in Computatioanl Chem

This posiiton is for a post-doc in the area of quantum chemistry/computational chemistry. The focus topic of the research for this candidate would be electronic structure of main group or transition metal clusters. Familiarity with computational quantum chemical techniques would be preferred.

Territory Sales Manager

About 5 years experience in selling or marketing in pharmaceutical or related field. Developing, servicing and providing technical support to major customers is a key element of the job.Job Profile�?�? To manage and conduct regular business review with major customers.�?�? Responsible for all selling & promotional activities for new products such as Vcaps and Licaps as well as customer service function as to achieve volume and average sale price target of the country.�?�? To fulfil the customer requirements and expectations and ensure customer satisfaction level.�?�? To gather market information and monitor market trends.�?�? Plan field visits so as to service customers in a timely manner and collect information on future requirements.�?�? To create action plan to incorporate with the long term goals of the division and provide feed back to the Sales Manager.�?�? To prepare weekly report on - market situation, trends and opportunities, customer information on products

bioinformatician(Drug discovery)

Structure based drug design Rational drug design protein modeling

Software Developers

Masters degree in Science or B.E. / B. Tech / M. Tech in Computer Science from reputed university. You should be expert in C++/VC++ and should have knowledge of OpenGL. Experience or exposure to the field of Bioinformatics / Cheminformatics is a must. You will be part of dedicated team developing new modules for our Molecular Design Suite (MDS) as well as developing custom-specific tools for clients. You will closely work with application scientists.

Experimental Scientists

You will be responsible for designing and implementation of in-vitro testing using biochemical assays and cell lines. You will also handle animal efficacy and toxicity testing. Ph.D. in Chemistry / Pharmacy / Life Sciences with specialization in the following areas: Pharmacology, Biochemistry. M.Sc. / M.Tech. / M. Pharm. with relevant industrial experience may also apply.

Head of Computational Chemistry

Our client has an exciting opportunity for a head of Computational Chemistry. This biopharmaceutical company is focused on the discovery of breakthrough treatments for human disease. We are currently recruiting for a proven computational chemist to build a cutting edge modeling and computational chemistry effort to support the drug discovery efforts of a department of approximately 50 chemists. In addition to expertise in modeling and computational technologies, the successful candidate will have the capacity to work independently within a highly focused team environment and demonstrate leadership, creativity and adaptability in their scientific work. This position requires a high degree of focus on scientific results, innovation, and team spirit coupled with strong organizational skills. Job objectives include the definition and acquisition of appropriate modeling software to support medicinal chemistry, the creation of pharmacophore, homology, QSAR and other empirical models and scientific interaction with experienced medicinal chemistry teams to generate structural hypotheses from project data. Several projects will also require accessing and manipulating crystallographic data, ligand docking to active sites and homology modeling. Qualified candidates must possess the following: Ph.D. in Chemistry 5 years of experience in drug discovery working with medicinal chemistry teams in a multidisciplinary project environment and a demonstrated ability to provide scientific leadership on a day-to-day basis.

Group Leader, Computational Chemist

Computational Chemistry We seek a scientist who will use structure-guided Computer Assisted Drug Design techniques to aid in the discovery and optimization of novel lead compounds for targets in selected protein families and will also assist the strategic direction of compound design in specific programs, and will be involved in prioritizing efforts in lead discovery, ADMET prediction and pre-clinical optimization. Extensive experience with iterative structure-guided compound optimization target projects in the context of strong medicinal chemistry is required. Experience with novel scaffold and combinatorial library design is preferred. Experience programming in Perl, C, Fortran, Java or C++ is required. Some experience in each of the following areas is essential: Protein binding site analyses, high-throughput 3D Pharmacophore and/or docking approaches, ab initio calculations, molecular dynamics simulations. Requires a PhD in Chemistry or a closely related field with at least 5 years experience in a research and development stage biotech or pharmaceutical company, including familiarity with the preclinical lead development process. Candidates should have a track record of accomplishments demonstrating technical proficiency, independent thought, scientific creativity, successful collaboration with others and excellent communication skills. Expert knowledge of scientific principles and concepts in the field is expected, as well as the ability to serve as a resource for colleagues. Experience with bioactive lead compound design in the Kinase, Phosphodiesterase and/or Nuclear Hormone Receptor protein families will be considered a plus.

Computational Scientists

You will apply advanced computational techniques to medicinal chemistry and life science projects for our clients and work closely with reputed clients. You should have sound knowledge of molecular modeling techniques applicable in structure-based drug design, ligand-based drug design, pharmacophore development, lead design and optimization, virtual screening and ADME properties Ph.D. in Chemistry / Pharmacy / Life Sciences with specialization in the following areas: Medicinal Chemistry, Biochemistry, Molecular Biology, Computational Chemistry, Computational Biology, Bioinformatics, Cheminformatics. M.Sc. / M.Tech. / M. Pharm. with relevant industrial experience may also apply. Experience in C/ C++/ Fortran code development would be desirable.

SENIOR SCIENTIST

Junior Chemist

We are a small company with seed-funding from angel investors. I am writing this as the HR recruiter for our company. Our goal is to synthesize pharmaceutical precursors for larger pharma companies in US and the E.U. for cheaper costs. We need highly competent self-motivated people who can work in teams. We are trying to fill the position of Junior Chemists. Needless to say, you should be an excellent organic-chemist and have no problem setting up a lab or assisting in the process. You will need the ability to synthesize organic compounds based on research done by senior researchers. Incompetence will not be tolerated.

Q.C. Chemist

Q.C. Chemist- 2nd or 3rd Shift- Mid Fairfield County- This is an employee-oriented manufacturer with a long, stable sales track record and many long term employees. You will be running wet chemistry and analytical tests on a wide range of products using GC, HPLC, AA, and IR. Requires a BS/BA in Chemistry, some background using HPLC, AA, GC, or IR. Entry level candidates will be considered, although one or more years of experience in analytical chemistry is preferred. The salary ranges from $35K for entry level, to $45K with experience, and they have excellent benefits here.

Research Associate

Structure based drug design for a leading Pharma company in Bangalore. Role would involve you to be actively involved in molecular based drug design

Research Scientist

Method development and validation with experience writing validation reports, thorough knowledge and recent hands-on experience using HPLC instruments (HP and/or Waters) with Turbochrome and/or ChemStation data acquisition systems knowledge and hands-on experience performing analysis by FTIR and water determinations by Generation of study protocols and executions Ability to monitor and input data into a specific inventory database for reference standards Handling of controlled drug substances and related compounds. Knowledge of GC, GC/MS, NMR and LC/MS Recent experience using computer programs to include Microsoft Word and Excel Ability to produce quality work with minimal supervision in a Laboratory environment and the ability to multi-task. MINIMUM REQUIREMENTS: BS or MS in chemistry or related discipline. 4-6 yrs. Pharmaceutical experience preferred. eoe/m/f/d/v

Scientist/Associate Director/Director

I am a recruiter & I have 2 positions available with a drug discovery company with a patented technology that accelerates the drug discovery process. They have collaborations with leading companies in addition to their own pipeline of small molecule drug candidates focused on CNS, cardiovascular, diabetes, immunology & oncology. They are looking for medicinal chemists at the Scientist level & at the Associate Director level to participate in Drug Discovery projects. This is very challenging work within a company that is fast paced & offers a lot of room for creativity & personal scientific growth. The company is small enough that the CEO knows each employee by name but successful enough to have attracted over $30 million in funding early this year. Job Description: The successful candidate will be responsible for synthetic methods development and process optimization for the rapid lead discovery and optimization of clinical drug candidates. Education/Experience Requirements: -Ph.D. synthetic, organic chemistry with a strong focus on synthesis -2 to 5 years of research experience in medicinal chemistry Essential experience and skills: -Strong skills and knowledge in synthetic organic chemistry and medicinal chemistry -Experience with analysis of complex structures preferred -Strong publication record -Demonstrated ability to plan research activities to achieve project goals and objectives -Ability to work in a multi-disciplinary environment -Short summary of your research including structure and chemical transformations. Aptitude and personality characteristics critical to job function: -High energy, active personality -Strong excitement about science and drug discovery -Excellent organization and presentation skills -Takes a proactive role in stimulating excellent communications with scientific colleagues -Strong commitment to teamwork -Strong desire to achieve

VP Chemistry

The company is developing new targets for intervention in chronic virus infections. They have a validated target for HIV-1 drug development with multiple small molecules. The Company has an extensive patent portfolio protecting this technology and new chemical entities. Current off-site chemistry is being coordinated by one of their Science Advisory Board members & his team. Job Description: This senior scientific leadership role will focus on building a chemistry program from the ground up. This is an exciting opportunity to work with novel anti-viral compounds in a creative, entrepreneurial setting. The person in this high visibility role will get to hand pick their team & set the strategic vision for the chemistry effort. They have a well established biology & HTS group & want to bring their chemistry effort in house. They are prepared to offer the right person a substantial equity position in the company & the tile of VP or Director depending on experience. Requirements: *Ph.D. Chemistry ' synthetic/organic or medicinal *10 to 15 years in a top tier pharmaceutical or biotech company ' combination of big pharma + biotech or a big biotech *Significant experience taking a small molecule from discovery through SAR through Phase II (ideal) *Will consider candidates with only strong clinical experience ' in this scenario they would also hire a Director of Pre-clinical Chemistry to handle pre-clinical projects *Experience with synthetic, medicinal & combinatorial chemistry in a drug discovery setting *Experience with anti-HIV or anti-viral compounds is a big plus *Experience with working with CRO's, getting compounds ready for the clinic & working with the FDA *Experience managing people, projects & programs *Must have established achievements & credentials *Must be articulate enough to present the work & able to talk with VC people

Sr. Research Assoc./Scientist

Postdoctoral research fellow or research associate position

Postdoctoral research fellow or research associate position is available immediately for studies of structure function activity of biological molecules in the Laboratory of Dr. Balendiran. Candidates with experience in (a) cloning, expression, purification, characterization, biochemical, biophysical analysis of proteins or (b) macromolecular crystallography are encouraged to apply. Primary responsibility will include large-scale production of target proteins, biochemical studies, crystallization and structure determination. Wide variety of projects from nucleic acids and sugar binding proteins are underway. Experience in computational or macromolecular crystallography will be helpful but not required. Opportunities to be part of several ongoing collaborations will give a chance to build an outstanding publication record in a short time. Please forward a CV with three letters of reference.

Sr. Research Assoc./Scientist

My client is a drug discovery company at the forefront of rational drug discovery. State-of-the-art facilities, great work environment, in one of the most desirable places in the country, San Diego, CA. They are looking for a medicinal, organic chemist at the BS, MS or Ph.D. level to participate in their drug discovery efforts. The position involves developing focused compound libraries for hit & lead identification on drug discovery targets. *Become fluent in structure-based drug design, especially as it relates to targets and homologs, and use these techniques in the design and synthesis of novel test compounds/compound sets for hit and lead identification. *Applying high-speed chemistry techniques wherever possible, design, develop, and construct focused compound libraries directed towards hit/lead identification on drug discovery targets. *Independently acquire and interpret data from chemistry experiments. *Actively pursue, develop, and utilize SAR that emerges within the drug discovery programs. *Interact closely with medicinal chemistry project teams and colleagues in other drug discovery disciplines in accord with the goals of the project team (analytical chemistry, computational chemistry, biology, crystallography, etc.). *Report details of the chemistry and related data at chemistry meetings, where appropriate. *Maintain a safe, clean laboratory area and a proper laboratory notebook. Requirements: *BS, MS or Ph.D. degree, organic/medicinal chemistry preferred *At the BS level, 5-8 years of industry experience in organic/medicinal chemistry in a drug discovery setting *At the MS level 2-5 yrs *At the Ph.D. level 1+ *Exp designing, developing & constructing compound libraries *Design & synthesis of novel test compounds & compound sets *Exp in hit & lead identification *Exp developing & using SAR profiles *Publications &/or patents *Exp with high speed chemistry techniques a plus *Exp in structure based drug design a plus

Group Lead/Principal Scientist

Based in San Diego California, this company is at the forefront of rational drug discovery and is currently developing therapeutics to treat cancer, metabolic diseases and inflammation. They are recognized as a leader in structure based drug design and their patented state-of-the-art technologies are used both for internal and external purposes, attracting collaborations with Big Pharma. Financially sound, in a pre-IPO status, this is an excellent time to join this growing company.Job Description: My company is looking for a medicinal, organic chemist to lead a small team & manage medicinal chemistry projects. The team is not in place yet so this position offers the opportunity to hand pick your own team & make your own project decisions. This is a great opportunity for someone who wants to be a very hands-on leader with a company that is poised for success.Requirements: *Ph.D. degree, organic/medicinal chemistry preferred *Industry experience in a biotech or pharmaceutical company 6 ' 10 years *Must have worked at a well-known biotech or pharmaceutical company *Must be fluent in structure-based drug design *Experience in structure-based drug design ' 2 years min *Experience with targets for whom the 3D structure has been determined by protein crystallography or computer generated protein structure models *Publications &/or patents *Project management a plus *Experience having taken a lead on to clinic

Lab Analyst/Technician

Computational Chemist

Chemistry PhD with 3-5 years of experience in computational chemistry/molecular modeling, QSAR/QSPR methods, competence in computer-aided molecular design and molecular mechanics/dynamics. Competence in modern techniques of computer-aided chemistry, biochemistry, bioinformartics algorithms, cheminformatics alogorithms that help discover and optimize potential lead compounds for drug discovery. Strong statistics background is also desirable. We are an exciting early-stage startup located in the Bay Area offering attractive equity for part or full-time employees.

Computational Chemist/Molecular Modeling Specialist

COMPUTATIONAL CHEMIST/ MOLECULAR MODELING SPECIALIST âWest of Boston, MA Exciting opportunity at an early stage biopharmaceutical company with a focus on structure based medicinal chemistry. This position will support our chemistry program by performing structure-based drug designs, virtual library generation and screening, and macromolecular modeling and docking using commercial software (Cerius2, Insight II, Catalyst, CombiFlexX, etc.) and other computational tools. Requires MS or Ph.D degree in computational Chemistry or Computational Biology together with extensive computer experience in a Unix and PC environment. Must also possess excellent verbal and written communication skills, and the ability to work with scientists from different disciplines. Company and recruiting firm strongly prefers working with local candidates only. Serious inquiries only.

High Throughput Screening/Assay Development Scientist

HIGH THROUGHPUT SCREENING/ ASSAY DEVELOPMENT & AUTOMATION West of Boston, MA Exciting opportunity at an early stage biopharmaceutical company with a focus on structure based medicinal chemistry. We are seeking an experienced MS or Ph.D. level scientist who will be responsible for the development, adaptation, and implementation of automated high-throughput biochemical screens aimed at identifying small molecule therapeutics. This position requires an experienced biochemist/enzymologist or cell biologist with a proven track record in the automation of screening assays, bioassay development and early drug candidate evaluation using multiple technology platforms. Experience with metabolic assays a plus. Company and recruiting firm strongly prefers working with local candidates only (Massachusetts and surrounding New England States). Serious inquiries only.

Medicinal Chemists-West of Boston, MA

MEDICINAL CHEMISTS West of Boston, MA Exciting opportunity at an early stage biopharmaceutical company with a focus on structure based medicinal chemistry. We are seeking several medicinal chemists at the MS and Ph.D. level to join our chemistry group. Successful applicants will design, synthesize, characterize and optimize small molecule drug candidates. These positions demand individuals comfortable working within a team environment and interacting with computer-assisted drug design chemists, biologists and biochemical pharmacologists. Qualified candidates will have a strong background in synthetic organic chemistry, proficiency in multi-step reactions and current spectroscopic techniques. Company and recruiting firm strongly prefers working with local candidates only (Massachusetts and surrounding New England States). Serious inquiries only.

Protein Chemist-Expression & Purification-West of Boston, MA

PROTEIN CHEMIST- Expression & Purification West of Boston, MA Exciting opportunity at an early stage biopharmaceutical company with a focus on structure based medicinal chemistry. We are seeking a protein chemist to perform protein expression, bioproduction, purification and characterization of natural and recombinant target proteins for the development of drug screening assays. This position requires prior experience in one or more of the following areas: bacterial, insect, and mammalian expression, protein purification, bioanalytical methods and enzymology. Must have Ph.D. in Biochemistry, Biophysics or Chemical Engineering. Company and recruiting firm strongly prefers working with local candidates only (Massachusetts and surrounding New England States). Serious inquiries only.

Research Associate, Analytical Chemistry, Cambridge, MA

Job Description: Research Associate: Analytical Chemistry, Cambridge, MA Description: Currently we are seeking a highly motivated individual to join our research and development group. The company is a leader in applying breakthroughs in understanding the chemistry and biology of complex sugars to the discovery, development, and commercialization of drug products. The ideal candidate will have 3-5 years industrial experience in analytical chemistry. Hands-on experience with various chromatography systems including different types of HPLC is highly desirable, as is experience with Elisa and other bioassays. Knowledge of Capillary Electrophoresis and Mass Spectrometry is a plus. This individual will work under the supervision of senior members of our research team on both the development of new assays to support process chemistry as well as the maintenance of assays already in place. The ideal candidate should be able and ready to work independently and creatively on assay development and do the necessary trouble-shooting to obtain desired solutions. Successful candidates will become members of cross -disciplinary, integrated research teams working in a dynamic, creative environment. Qualifications: B.S or M.S Degree in Organic Chemistry, Analytical Chemistry, Pharmaceutical Sciences Chemistry or related disciplines 3-5 years industrial experience in analytical chemistry Collaborative ability; ability to work in teams Ability to work independently on projects and troubleshoot problems Excellent communication and organizational skills are essential Company and recruiting firm strongly prefers working with local candidates only. Serious inquiries only.

Program Director

We are recruiting for a Program Director , the goal of which is to increase academic access to molecular probes identified by high throughput molecular screening (HTS) and to broaden the application of HTS in the study of biology and disease. This individual will be a key contributor to NINDS activities related to the Molecular Libraries Roadmap, including assay development, high throughput screening, establishment of compound libraries, and technology development. These activities will include leadership in programs to encourage the use of HTS through 1) the development of a broad range of novel biological assays for HTS and 2) the generation of a bioactive compound collection for distribution to the research community. Although experience with assays for compound screening is expected, relevant experience may include research in cell biology, molecular biology, or pharmacology in academic or for-profit institutions. The successful candidate will join a highly interactive group of scientists directing research programs in a wide range of areas of biomedical science at the NIH. He/she will maintain active communication with the extramural professional community as well as with program staff in other government institutes and agencies.

M.Sc., Chemistry Fresher looking for job

Lab technician Lab assistant, Chemist, These all are the field i like to give my performance.

Looking for candidates with 8 to 10 years of experience in Medicinal chemistry with at least 2 years of managerial experience

Position : GM ? Medicinal chemistry Department : Discovery Research Education : Ph D / post doc. in chemistry /medicinal chemistry Experience : 7- 10 years in pharma/ biotech / related industry with atleast 1-2yrs in a managerial position. Location : Bangalore Description: ------ Responsible to lead a medicinal chemistry project team in delivering candidate molecule. ------ Responsible to design and synthesize drug development candidates. ------ Should have significant medicinal chemistry experience including scaffold design,library synthesis, hit to lead optimization etc. ------ Work closely with biologists/ computational chemists / pharmacologists to advance the drug discovery portfolio ------ Collaborating with other strategic unit heads in providing scientific knowledge and inputs supporting business growth. ------ Contribute to strategic planning and development of the chemistry department ------ Prepare and deliver quality presentations & reports. Preferred candidates: ------ He/ She must be focused, possess the ability to meet and exceed expectations. ------ Must have an outstanding communication (oral & written) & interpersonal skills; desire to work in a dynamic team environment. ------ Track record of management experience ------ Proven track record of scientific excellence demonstrated by publication history & scientific reputation. ------ Exposure to computational chemistry tools / discovery biology will be an added advantage.

Research associate in R&D of RSIL ltd.

Sr. scientist, high-throughput screening

We presently seek a Scientist or Sr. Scientist to lead a team dedicated to high-throughput (HTS) drug screening. Since this position will entail oversight of an HTS team, excellent communication and leadership skills are required. Candidates should have a Ph.D. in Pharmacology or related field with a track record of sustained achievement. The position requires >7 years of post-graduate research experience and applicants should have recently led a HTS research team in a commercial setting. The preferred candidate will have prior experience with GPCR, ion channel and enzyme drug targets, and should be familiar with screens that utilize fluorescent (FLIPR, FRET & FP) or isotopic (SPA) methods.

Sr. Scientist/Group Leader - Medicinal Chemistry

We presently seek Sr. Scientists or Group Leaders in the area of Medicinal Chemistry. Ph.D. in organic or medicinal chemistry; 4-6 years of experience subsequent to receiving their advanced degree; highly motivated scientists with a record of productivity in the areas of synthetic and medicinal chemistry; preference will be given to candidates with experience in the pharmaceutical or biotechnology industries; expertise in multi-step organic synthesis; hands-on experience with solid- and liquid-phase combinatorial chemistry methodologies; spectroscopic and chromatographic techniques; molecular modeling; chemical database software; lead an initial group of 3-5 Ph.D. and BS/MS level chemists; positions will report directly to the Director of Chemistry.

Research Scientist/Associate

Qualification: MSc. Analytical Chemistry Min 4-5 yrs of exp. in Analytical Development Lab. Should have handled GC, GCMS and HPLC. Must possess good analytical data interpretation, trouble shooting and experiment planning skills. Awareness of GLP and GMP and expertise in developing GC methods for low volatile fluorinated compounds will be an added advantage Candidates who have experience in API industry will be preferred

GET

GET for Technical Services Dept Qualification : B.Tech Chemical Engg Exp: Fresher or 6 months exp.

Qc Chemist

Analysis

Postdoctoral Fellow

The University of Kansas Molecular Graphics and Modeling Laboratory is seeking a postdoctoral fellow with a diverse array of modeling skills including a background in at least one of the fields of theoretical chemistry, virtual drug design, and/or computational biochemistry. Approximately 50% of the associated responsibilities will entail molecular docking and quantum chemical research as applied to enzyme catalysis and inhibition. The remaining responsibilities will entail other miscellaneous modeling activities, as well as some software and systems maintenance. The position will be funded at the rate of $28,000 / annum for one year, with possible extension to a second year. The position will be supported in part by the U.S. Department of Defense and may entail access to DOD high performance computing resources, thus American citizens are preferred. A Ph.D. (or equivalent practical experience) in theoretical chemistry, virtual drug design, or computational biochemistry is required. The position is available starting March 31, 2003 (possibly earlier by mutual consent). Interested applicants should forward curriculum vitae and two letters of recommendation to Gerald Lushington (glushington@ku.edu) by January 31, 2003.

Computational Biologist/Modeller

We are working for the Department of Defense and seeking a Computational Biologist/Modeler to support our operations in Ohio. Ideal candidate will possess the following: (1) Ph.D. in toxicology or related biomedical discipline; (2) journal publications demonstrating experience in physiologically based pharmacokinetic (PBPK) and/or pharmacodynamic (PD) modeling; (3) demonstrated experience with simulation software language (preferably ACSL) and/or other biosimulation software programs (i.e. MatLab); (4) demonstrated excellence in analytical, verbal, and written communication skills; and (5) applicant must be a U.S. Citizen or have a resident alien status. Preferred candidates will possess: (1) Demonstrated application of PBPK or PD models in risk assessment process; (2) demonstrated integration of molecular biology data into PBPK or PD models; and (3) experience in working with multi-disciplinary research teams. Essential duties: (1) Develop PBPK models describing the uptake, distribution, metabolism (and other chemical interactions), and elimination of chemicals in biological systems; (2) develop PD models integrating molecular biology data; (3) design, develop and conduct experimental studies in support of model development; (4) interact with laboratory scientists and associates in a team research environment; and (5) interpret study results and communicate findings at scientific meetings and in peer-reviewed journals.

chemist

good chemist job in chemical idustries

Sr. Analyst/Group Leader

1) Develop & validate analytical method as per Standard Operating Procedure(SOP). 2) Accompany service engineer in case of maintenance. 3) Operate, maintain & calibrate various lab. equipments. 4) Prepare project specific lab. documents for assigned projects. 5) Prepare report for method validation & analytical part of biostudy. 6) Prepare & update analytical & general SOPs.

Sr. Research Officer

Job Description Analysis of R&D samples and new method development. Conducting stability studies as per schedule; Calibration of Analytical Instruments, Handling the shift independently, Development of working reference standards for finished products, Validation of new Analytical methods, Documentation as per ISO requirements, etc. Responsibility: To carry out testing and inspection for all new raw materials, in-process reaction monitoring samples and finished products. Inspection and testing would encompass both wet analysis and instrumental methods of analysis. To maintain all testing records in line with ISO-9001 and cGMP requirements.

Head-Quality

� To head Quality Assurance and Quality control departments. � Overall responsibilities of Quality Control, Shift management & work allocation, Instruments availability, stability studies, calibration, Laboratory Control. � Support to SHE in effluent characterization. � Monitoring the cost incurred by QA, CAPEX Planning. � Support for Analytical method development for new products and new raw materials. � Support for new supplier development for existing raw materials. � Monitoring / Implementation of cGMP practices in the plant, validations, handling of customer complaints, customer visits, audits � To provide necessary analytical support for filing dossiers for new products. � Validation of analytical methods, documentation as per ISO requirements etc. Key Responsibilities : � To guide analytical team in new method development for raw materials and finished products. � To provide timely support to marketing in addressing customer complaints. � To ensure improvements in the implemented quality systems. � Overall responsibility of QA and QC.

Head-Quality

chemist in uae ,soudi,oman

fresher

Research Associate

Will independently conduct the synthesis, isolation, purification, and analysis of novel small molecule compounds for biological screening in a multidiscipline environment under the supervision of a senior chemist. Profund knowledge in organic synthesis, proven problem solving skills and analytical skills,HPLC,GC,IR,NMR,MS/LC.

m.sc.biochem

bassic on m,sc.

Research Associate - Organic Chemistry

Will perform small molecule inhibitor and intermediate synthesis, and conduct literature and lab research. As part of a team, individual will evaluate new procedures and techniques to develop probe platform. BS or MS in Chemistry and 2+ years relevant experience. Experience in a pharmaceutical lab environment is required.

Medicinal Chemist-Drug Discovery

In this lab position, will be responsible for conducting the syntheses of organic compounds for pharmaceutical applications. Experience with polymer synthesis is a plus. Experience in the preparation of water soluble and water dispersible materials is desired. This position requires expertise in devising efficient synthetic routes to target compounds. Other required skills include: the safe and appropriate use of reagents, the safe and appropriate disposal of chemical waste, careful record keeping, analytical characterization of small molecules (NMR, IR, MS, HPLC, G, TLC). Professional standards of lab cleanliness and maintenance are expected. Additionally, you will also posses excellent communication and leadership skills. In this role you will be expected to participate in group meetings. Familiarity with MS word, MS Excel, Chem Draw, ISIS, and PowerPoint. A PhD in synthetic organic chemistry with 2+ years of experience in medicinal or polymer chemistry or an MS in synthetic organic chemistry with 5+ years of experience in medicinal or polymer chemistry is required. Contract role: no sponsorship or relocation offered

application for the post of research associate

Research Scientist ? Process Research

Qualification: - M. Sc (Organic Chemistry) / PhD Experience ? 6-8yrs He should have exposure in trouble shooting & pilot plant scale ? ups for APIs.

Senior Research Scientist ? Process Research

Qualification: - M. Sc (Organic Chemistry) / PhD Experience ? 8-10yrs He should have exposure in trouble shooting & pilot plant scale ? ups for APIs.

Research Officer, Research Executive

Candidate should have an experience in product development,he would responsilble for technology transfer.candidate with B.Pharm,M.Pharm who has work in regulated market. Experience- 2-5 Years.

Senior Medicinal Chemists

As a key member of our medicinal chemistry endeavors, you will be responsible for the design and synthesis of novel compounds for evaluation as potential drugs. The ideal candidates have a keen desire to independently derive SAR hypotheses, conduct multi-step synthetic sequences and have superior analytical skills. He or She must possess extensive understanding and accomplishments in practicing medicinal chemistry. The successful candidate will possess a Ph.D. in Organic Chemistry with 5-15 years experience working in an industrial environment. He or She must be an excellent team player as well as have the ability to work independently and possess excellent communication skills. Our culture is based on professionalism, honesty, integrity and excellence. Dalton offers full service capabilities in drug development and manufacturing, including peptide synthesis and sterile fill of finished products in our world-class GMP facilities. We offer a competitive salary and benefits. Please forward your resume to: E-mail: hr@dalton.com

CHEMIST

Yahoo!My Yahoo!Mail Make Y! your home pageYahoo! SearchSearch:Welcome, praca84 [Sign Out, My Account]Mail Home -Mail Tutorials -Help Mail | Addresses | Calendar | Notepad Yahoo! on Mobile - Upgrades - Options Check MailCompose Search MailSearch the Web A card in 3 days for bad credit* Folders[Add - Edit] Inbox (53) Draft Sent Bulk (1)[Empty] Trash[Empty] My Folders[Show] Search Shortcuts My Photos My Attachments See your credit score: $0 No Form Filling Just Upload CV Watch Videos On Yahoo! Music Jobs in your city ! You can receive a SMS text alert when this person sends you Mail. Please register for mail alerts to activate this service. Previous | Next | Back to Messages Call or Instant Message DeleteReplyForwardMove... Printable View This message is not flagged. [ Flag Message - Mark as Unread ] Date: Fri, 27 Oct 2006 22:34:57 -0700 (PDT) From: "PRAKASH DEVI" Add to Address Book Add Mobile Alert Subject: Re: reresume To: bucareer@careervarsitry.com CC: maorgdev@vedanta.co.in ----- Original Message ---- From: PRAKASH DEVI To: ajay@prime.com Sent: Tuesday, October 24, 2006 11:30:36 AM Subject: Re: reresume ----- Original Message ---- From: PRAKASH DEVI To: sysmanagement@sify.com Sent: Saturday, September 23, 2006 8:27:13 PM Subject: reresume I LIKE THIS COMPANY SO IF ANY VACANCY ,\.I WILL JOIN RESUME S.PRAKASH S/oM,SENGODU E.33 PERIYAR NAGAR ERODE.638001 Mobile No:9894889550 E-mail :PRACA84 @Yahoo.com. 1.Objective To apply my maximium potential in every work I do,regartless of the benefits I get. I would like to chemist,wherever I work. 2.Acadamic Qualification M.Sc.Chemistry 3.Educational Qualification COURSE INSTITUTION BOARD/UNIVERSITY PERCENTAGE OF MARKS S.S.L.C CSI Boys Hr.Sec.School,Erode. State Board 75.7% H.S.C CSI Boys Hr.Sec.School,Erode. State Board 72.4% B.Sc Chemistry Sri Vasavi College Erode. Bharathiar university 71.3% M.Sc Chemistry Sri Ramakrishna Mission Vidyalaya Coimbatore . Bharathiar university 73.5% 3.Project Project Name :Synthesis&Characterisation of Nickel complexes Organization:SRKV Coimbatore Year :2005-2006 4.Sports Participated in inter school Annual sports meet at cricket. 5.Personal Details Name : S.PRAKASH Father name : M.SENGODU Date of birth : 03/06/84 Sex : Male Nationality : Indian Martial : Single Languages known : English,Tamil 6.Experience : 4 months in teaching field I do hereby confirm that the information given in this form is true to the best of my knowledge and belief Date: 23.09.06 Yours faithfully (S.PRAKASH)

Biochemistry job

Teaching / related

Trainee in Structural Bioinformatics, Biomolecular Modeling

Within the frame of EnTec's participation in the Jena Centre for Bioinformatics, we are seeking for a bright, highly motivated and adaptive candidate to temporarily endorse our structural bioinformatics/ rational drug design group. Job description: The successful candidate will work on a collaborative research project with Global Research (GHC) of Schering AG. (S)He will be responsible for in silico identification of putative receptor sequences for a growth factor protein, homology modeling of suitable candidates, and for performing molecular dynamics refinement and docking simulations of the generated structures. The position is available for 3 months. Qualification: The successful candidate will be preferably a Bioinformatics/Biochemistry/Chemistry undergraduate with basic knowledge of /Willingness to learn genomic/protein sequence database search and analysis methods and tools. Skills with operating systems (LINUX, UNIX, NT) and scripting languages (e.g. perl, awk/sed) are desirable. Candidates interested in improving their curriculum and gaining valuable experience in the field of structural bioinformatics/ molecular modeling and simulation while being closely integrated in product-oriented drug discovery pharmaceutical industry project are encouraged to send resumes and contact information as well as salary expecteations to the contact person.

RESEACH ASSOCITE

I HAVE COMPLETED BSC WITH CHEMISTRY AND MSC WITH BIO CHEMISTRY IHAVE CAPABILITY TO HANDLE ANY EQUPEMENT IN MY RELATED MY FILD . I HAVE EXPERENCE IN PROTEN MODELING AND DRUG DESIGN

Consultant - Toxicology Scientific Director

TASC Laboratory Inc. is an established 25 year toxicology laboratory located in Phoenix, AZ dedicated to urine drug of abuse testing. We are in search of a scientific director on a consultant basis. This position would require on site visits on a monthly basis only. We are very flexible as to the scheduling of the monthly visits. Telephonic consultation may be necessary on a limited basis. Listed below are the minimum qualifications required by C.A.P. The scientific director of the drug testing laboratory is an individual with documented scientific qualifications comparable to those persons certified by the American Board of Forensic Toxicology or a PhD degree with certification in toxicological chemistry by the American Board of Clinical Chemistry. Alternative acceptable qualifications include an MD degree with certification in clinical and/or forensic pathology and at least two years of active laboratory experience in analytical toxicology. All alternative qualifications also require documented training and/or experience with the forensic applications of analytical toxicology (such as court testimony, research, participation in continuing education programs, and review of publications.) Interested parties may contact: Gail French, General Laboratory Supervisor gfrench@tascaz.org OR Douglas Kramer, Technical Laboratory Supervisor dkramer@tascaz.org Treatment Assessment Screening Center, Inc. 2234 N. 7th Street Phoenix, Arizona 85006 Phone (602) 257-7588 Fax (602) 257-7590

sales

a comany with a good sence of developement, a good potencial copoment company.

any suitable job for my qualification